ID: 908299216

View in Genome Browser
Species Human (GRCh38)
Location 1:62745456-62745478
Sequence CATCCTAGGCCAGTTGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908299216_908299222 9 Left 908299216 1:62745456-62745478 CCTCTCTCAACTGGCCTAGGATG No data
Right 908299222 1:62745488-62745510 TGTAGAGCACAGGCATATTTAGG No data
908299216_908299221 -1 Left 908299216 1:62745456-62745478 CCTCTCTCAACTGGCCTAGGATG No data
Right 908299221 1:62745478-62745500 GGGATGGAACTGTAGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908299216 Original CRISPR CATCCTAGGCCAGTTGAGAG AGG (reversed) Intergenic
No off target data available for this crispr