ID: 908299219

View in Genome Browser
Species Human (GRCh38)
Location 1:62745462-62745484
Sequence TCAACTGGCCTAGGATGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908299213_908299219 4 Left 908299213 1:62745435-62745457 CCAGTGGAAGAGTCTGTTCTTCC No data
Right 908299219 1:62745462-62745484 TCAACTGGCCTAGGATGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908299219 Original CRISPR TCAACTGGCCTAGGATGGGA TGG Intergenic
No off target data available for this crispr