ID: 908299222

View in Genome Browser
Species Human (GRCh38)
Location 1:62745488-62745510
Sequence TGTAGAGCACAGGCATATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908299216_908299222 9 Left 908299216 1:62745456-62745478 CCTCTCTCAACTGGCCTAGGATG No data
Right 908299222 1:62745488-62745510 TGTAGAGCACAGGCATATTTAGG No data
908299220_908299222 -5 Left 908299220 1:62745470-62745492 CCTAGGATGGGATGGAACTGTAG No data
Right 908299222 1:62745488-62745510 TGTAGAGCACAGGCATATTTAGG No data
908299213_908299222 30 Left 908299213 1:62745435-62745457 CCAGTGGAAGAGTCTGTTCTTCC No data
Right 908299222 1:62745488-62745510 TGTAGAGCACAGGCATATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908299222 Original CRISPR TGTAGAGCACAGGCATATTT AGG Intergenic
No off target data available for this crispr