ID: 908311889

View in Genome Browser
Species Human (GRCh38)
Location 1:62892373-62892395
Sequence GCCACAGTACGCAAACATTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908311889_908311893 30 Left 908311889 1:62892373-62892395 CCGCAATGTTTGCGTACTGTGGC No data
Right 908311893 1:62892426-62892448 TAGTCCCTCAGAAACCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908311889 Original CRISPR GCCACAGTACGCAAACATTG CGG (reversed) Intergenic