ID: 908311889 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:62892373-62892395 |
Sequence | GCCACAGTACGCAAACATTG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
908311889_908311893 | 30 | Left | 908311889 | 1:62892373-62892395 | CCGCAATGTTTGCGTACTGTGGC | No data | ||
Right | 908311893 | 1:62892426-62892448 | TAGTCCCTCAGAAACCCAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
908311889 | Original CRISPR | GCCACAGTACGCAAACATTG CGG (reversed) | Intergenic | ||