ID: 908311893

View in Genome Browser
Species Human (GRCh38)
Location 1:62892426-62892448
Sequence TAGTCCCTCAGAAACCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908311889_908311893 30 Left 908311889 1:62892373-62892395 CCGCAATGTTTGCGTACTGTGGC No data
Right 908311893 1:62892426-62892448 TAGTCCCTCAGAAACCCAGCTGG No data
908311890_908311893 8 Left 908311890 1:62892395-62892417 CCCATTTTCAGATCTCATTGTAT No data
Right 908311893 1:62892426-62892448 TAGTCCCTCAGAAACCCAGCTGG No data
908311891_908311893 7 Left 908311891 1:62892396-62892418 CCATTTTCAGATCTCATTGTATC No data
Right 908311893 1:62892426-62892448 TAGTCCCTCAGAAACCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908311893 Original CRISPR TAGTCCCTCAGAAACCCAGC TGG Intergenic
No off target data available for this crispr