ID: 908319052

View in Genome Browser
Species Human (GRCh38)
Location 1:62963370-62963392
Sequence GATCCTGCCTCCTAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908319052_908319060 17 Left 908319052 1:62963370-62963392 CCTGACCACTAGGAGGCAGGATC No data
Right 908319060 1:62963410-62963432 GGCAGGCTCACCCAGGGGCCTGG No data
908319052_908319054 -4 Left 908319052 1:62963370-62963392 CCTGACCACTAGGAGGCAGGATC No data
Right 908319054 1:62963389-62963411 GATCACATTACCTAACTCACTGG No data
908319052_908319059 12 Left 908319052 1:62963370-62963392 CCTGACCACTAGGAGGCAGGATC No data
Right 908319059 1:62963405-62963427 TCACTGGCAGGCTCACCCAGGGG No data
908319052_908319055 0 Left 908319052 1:62963370-62963392 CCTGACCACTAGGAGGCAGGATC No data
Right 908319055 1:62963393-62963415 ACATTACCTAACTCACTGGCAGG No data
908319052_908319058 11 Left 908319052 1:62963370-62963392 CCTGACCACTAGGAGGCAGGATC No data
Right 908319058 1:62963404-62963426 CTCACTGGCAGGCTCACCCAGGG No data
908319052_908319057 10 Left 908319052 1:62963370-62963392 CCTGACCACTAGGAGGCAGGATC No data
Right 908319057 1:62963403-62963425 ACTCACTGGCAGGCTCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908319052 Original CRISPR GATCCTGCCTCCTAGTGGTC AGG (reversed) Intergenic
No off target data available for this crispr