ID: 908319897

View in Genome Browser
Species Human (GRCh38)
Location 1:62968970-62968992
Sequence ATTTCTGTGCTGAATGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908319897_908319905 29 Left 908319897 1:62968970-62968992 CCCAGCACATTCAGCACAGAAAT No data
Right 908319905 1:62969022-62969044 CTAGGACAGCAAACAACAGGAGG No data
908319897_908319901 -1 Left 908319897 1:62968970-62968992 CCCAGCACATTCAGCACAGAAAT No data
Right 908319901 1:62968992-62969014 TAAATGCACAGATATGGACTGGG No data
908319897_908319899 -7 Left 908319897 1:62968970-62968992 CCCAGCACATTCAGCACAGAAAT No data
Right 908319899 1:62968986-62969008 CAGAAATAAATGCACAGATATGG No data
908319897_908319902 0 Left 908319897 1:62968970-62968992 CCCAGCACATTCAGCACAGAAAT No data
Right 908319902 1:62968993-62969015 AAATGCACAGATATGGACTGGGG No data
908319897_908319904 26 Left 908319897 1:62968970-62968992 CCCAGCACATTCAGCACAGAAAT No data
Right 908319904 1:62969019-62969041 GTGCTAGGACAGCAAACAACAGG No data
908319897_908319903 11 Left 908319897 1:62968970-62968992 CCCAGCACATTCAGCACAGAAAT No data
Right 908319903 1:62969004-62969026 TATGGACTGGGGCAAGTGCTAGG No data
908319897_908319900 -2 Left 908319897 1:62968970-62968992 CCCAGCACATTCAGCACAGAAAT No data
Right 908319900 1:62968991-62969013 ATAAATGCACAGATATGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908319897 Original CRISPR ATTTCTGTGCTGAATGTGCT GGG (reversed) Intergenic
No off target data available for this crispr