ID: 908321525

View in Genome Browser
Species Human (GRCh38)
Location 1:62983394-62983416
Sequence TGTCAGGTAGAGAGCCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908321522_908321525 -4 Left 908321522 1:62983375-62983397 CCATGTGTCTGATCTGTCTTGTC No data
Right 908321525 1:62983394-62983416 TGTCAGGTAGAGAGCCTTGTGGG No data
908321521_908321525 15 Left 908321521 1:62983356-62983378 CCTCAGTAGTCGCTATGCTCCAT No data
Right 908321525 1:62983394-62983416 TGTCAGGTAGAGAGCCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908321525 Original CRISPR TGTCAGGTAGAGAGCCTTGT GGG Intergenic
No off target data available for this crispr