ID: 908321591

View in Genome Browser
Species Human (GRCh38)
Location 1:62983869-62983891
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908321586_908321591 -7 Left 908321586 1:62983853-62983875 CCTTTAACCTCTGCTCTCTCATC No data
Right 908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr