ID: 908324252

View in Genome Browser
Species Human (GRCh38)
Location 1:63007648-63007670
Sequence CTGCCAGGAGGGAGGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908324246_908324252 1 Left 908324246 1:63007624-63007646 CCTCAAAAAAAAAAAAAAAAAAT 0: 216
1: 7451
2: 24063
3: 31786
4: 76439
Right 908324252 1:63007648-63007670 CTGCCAGGAGGGAGGAAGAAGGG No data
908324244_908324252 6 Left 908324244 1:63007619-63007641 CCCTGCCTCAAAAAAAAAAAAAA 0: 803
1: 14764
2: 18397
3: 39449
4: 163102
Right 908324252 1:63007648-63007670 CTGCCAGGAGGGAGGAAGAAGGG No data
908324243_908324252 25 Left 908324243 1:63007600-63007622 CCTGGGTGACACAGTGAGACCCT 0: 375
1: 9015
2: 32100
3: 85607
4: 170274
Right 908324252 1:63007648-63007670 CTGCCAGGAGGGAGGAAGAAGGG No data
908324245_908324252 5 Left 908324245 1:63007620-63007642 CCTGCCTCAAAAAAAAAAAAAAA 0: 833
1: 14576
2: 18633
3: 42286
4: 172953
Right 908324252 1:63007648-63007670 CTGCCAGGAGGGAGGAAGAAGGG No data
908324242_908324252 29 Left 908324242 1:63007596-63007618 CCAGCCTGGGTGACACAGTGAGA 0: 1468
1: 36819
2: 91431
3: 177348
4: 206241
Right 908324252 1:63007648-63007670 CTGCCAGGAGGGAGGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908324252 Original CRISPR CTGCCAGGAGGGAGGAAGAA GGG Intergenic
No off target data available for this crispr