ID: 908326560

View in Genome Browser
Species Human (GRCh38)
Location 1:63029110-63029132
Sequence CTGCTCACCTGCACCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908326560_908326564 7 Left 908326560 1:63029110-63029132 CCAGCTGGGGTGCAGGTGAGCAG No data
Right 908326564 1:63029140-63029162 TGAAGGACATAGTTATGCAGAGG No data
908326560_908326563 -10 Left 908326560 1:63029110-63029132 CCAGCTGGGGTGCAGGTGAGCAG No data
Right 908326563 1:63029123-63029145 AGGTGAGCAGGGAAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908326560 Original CRISPR CTGCTCACCTGCACCCCAGC TGG (reversed) Intergenic
No off target data available for this crispr