ID: 908331405

View in Genome Browser
Species Human (GRCh38)
Location 1:63074463-63074485
Sequence CAGTGTGGAGGTGAACCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908331405_908331415 23 Left 908331405 1:63074463-63074485 CCATGGGGTTCACCTCCACACTG No data
Right 908331415 1:63074509-63074531 GCCCGCGCGGCCTCTGCCAAGGG No data
908331405_908331411 10 Left 908331405 1:63074463-63074485 CCATGGGGTTCACCTCCACACTG No data
Right 908331411 1:63074496-63074518 GACCGCGCTACCAGCCCGCGCGG No data
908331405_908331414 22 Left 908331405 1:63074463-63074485 CCATGGGGTTCACCTCCACACTG No data
Right 908331414 1:63074508-63074530 AGCCCGCGCGGCCTCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908331405 Original CRISPR CAGTGTGGAGGTGAACCCCA TGG (reversed) Intergenic
No off target data available for this crispr