ID: 908331408

View in Genome Browser
Species Human (GRCh38)
Location 1:63074475-63074497
Sequence TCCTGGCAGCCGCAGTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908331408_908331411 -2 Left 908331408 1:63074475-63074497 CCTCCACACTGCGGCTGCCAGGA No data
Right 908331411 1:63074496-63074518 GACCGCGCTACCAGCCCGCGCGG No data
908331408_908331419 22 Left 908331408 1:63074475-63074497 CCTCCACACTGCGGCTGCCAGGA No data
Right 908331419 1:63074520-63074542 CTCTGCCAAGGGCCCGCTGATGG No data
908331408_908331414 10 Left 908331408 1:63074475-63074497 CCTCCACACTGCGGCTGCCAGGA No data
Right 908331414 1:63074508-63074530 AGCCCGCGCGGCCTCTGCCAAGG No data
908331408_908331420 25 Left 908331408 1:63074475-63074497 CCTCCACACTGCGGCTGCCAGGA No data
Right 908331420 1:63074523-63074545 TGCCAAGGGCCCGCTGATGGAGG No data
908331408_908331422 30 Left 908331408 1:63074475-63074497 CCTCCACACTGCGGCTGCCAGGA No data
Right 908331422 1:63074528-63074550 AGGGCCCGCTGATGGAGGCGAGG No data
908331408_908331415 11 Left 908331408 1:63074475-63074497 CCTCCACACTGCGGCTGCCAGGA No data
Right 908331415 1:63074509-63074531 GCCCGCGCGGCCTCTGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908331408 Original CRISPR TCCTGGCAGCCGCAGTGTGG AGG (reversed) Intergenic
No off target data available for this crispr