ID: 908331409

View in Genome Browser
Species Human (GRCh38)
Location 1:63074478-63074500
Sequence CGGTCCTGGCAGCCGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908331409_908331419 19 Left 908331409 1:63074478-63074500 CCACACTGCGGCTGCCAGGACCG No data
Right 908331419 1:63074520-63074542 CTCTGCCAAGGGCCCGCTGATGG No data
908331409_908331414 7 Left 908331409 1:63074478-63074500 CCACACTGCGGCTGCCAGGACCG No data
Right 908331414 1:63074508-63074530 AGCCCGCGCGGCCTCTGCCAAGG No data
908331409_908331423 28 Left 908331409 1:63074478-63074500 CCACACTGCGGCTGCCAGGACCG No data
Right 908331423 1:63074529-63074551 GGGCCCGCTGATGGAGGCGAGGG No data
908331409_908331415 8 Left 908331409 1:63074478-63074500 CCACACTGCGGCTGCCAGGACCG No data
Right 908331415 1:63074509-63074531 GCCCGCGCGGCCTCTGCCAAGGG No data
908331409_908331422 27 Left 908331409 1:63074478-63074500 CCACACTGCGGCTGCCAGGACCG No data
Right 908331422 1:63074528-63074550 AGGGCCCGCTGATGGAGGCGAGG No data
908331409_908331420 22 Left 908331409 1:63074478-63074500 CCACACTGCGGCTGCCAGGACCG No data
Right 908331420 1:63074523-63074545 TGCCAAGGGCCCGCTGATGGAGG No data
908331409_908331411 -5 Left 908331409 1:63074478-63074500 CCACACTGCGGCTGCCAGGACCG No data
Right 908331411 1:63074496-63074518 GACCGCGCTACCAGCCCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908331409 Original CRISPR CGGTCCTGGCAGCCGCAGTG TGG (reversed) Intergenic
No off target data available for this crispr