ID: 908331410

View in Genome Browser
Species Human (GRCh38)
Location 1:63074492-63074514
Sequence GCGGGCTGGTAGCGCGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908331410_908331419 5 Left 908331410 1:63074492-63074514 CCAGGACCGCGCTACCAGCCCGC No data
Right 908331419 1:63074520-63074542 CTCTGCCAAGGGCCCGCTGATGG No data
908331410_908331422 13 Left 908331410 1:63074492-63074514 CCAGGACCGCGCTACCAGCCCGC No data
Right 908331422 1:63074528-63074550 AGGGCCCGCTGATGGAGGCGAGG No data
908331410_908331420 8 Left 908331410 1:63074492-63074514 CCAGGACCGCGCTACCAGCCCGC No data
Right 908331420 1:63074523-63074545 TGCCAAGGGCCCGCTGATGGAGG No data
908331410_908331423 14 Left 908331410 1:63074492-63074514 CCAGGACCGCGCTACCAGCCCGC No data
Right 908331423 1:63074529-63074551 GGGCCCGCTGATGGAGGCGAGGG No data
908331410_908331414 -7 Left 908331410 1:63074492-63074514 CCAGGACCGCGCTACCAGCCCGC No data
Right 908331414 1:63074508-63074530 AGCCCGCGCGGCCTCTGCCAAGG No data
908331410_908331415 -6 Left 908331410 1:63074492-63074514 CCAGGACCGCGCTACCAGCCCGC No data
Right 908331415 1:63074509-63074531 GCCCGCGCGGCCTCTGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908331410 Original CRISPR GCGGGCTGGTAGCGCGGTCC TGG (reversed) Intergenic