ID: 908331411

View in Genome Browser
Species Human (GRCh38)
Location 1:63074496-63074518
Sequence GACCGCGCTACCAGCCCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908331405_908331411 10 Left 908331405 1:63074463-63074485 CCATGGGGTTCACCTCCACACTG No data
Right 908331411 1:63074496-63074518 GACCGCGCTACCAGCCCGCGCGG No data
908331409_908331411 -5 Left 908331409 1:63074478-63074500 CCACACTGCGGCTGCCAGGACCG No data
Right 908331411 1:63074496-63074518 GACCGCGCTACCAGCCCGCGCGG No data
908331408_908331411 -2 Left 908331408 1:63074475-63074497 CCTCCACACTGCGGCTGCCAGGA No data
Right 908331411 1:63074496-63074518 GACCGCGCTACCAGCCCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908331411 Original CRISPR GACCGCGCTACCAGCCCGCG CGG Intergenic
No off target data available for this crispr