ID: 908331411 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:63074496-63074518 |
Sequence | GACCGCGCTACCAGCCCGCG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
908331408_908331411 | -2 | Left | 908331408 | 1:63074475-63074497 | CCTCCACACTGCGGCTGCCAGGA | No data | ||
Right | 908331411 | 1:63074496-63074518 | GACCGCGCTACCAGCCCGCGCGG | No data | ||||
908331409_908331411 | -5 | Left | 908331409 | 1:63074478-63074500 | CCACACTGCGGCTGCCAGGACCG | No data | ||
Right | 908331411 | 1:63074496-63074518 | GACCGCGCTACCAGCCCGCGCGG | No data | ||||
908331405_908331411 | 10 | Left | 908331405 | 1:63074463-63074485 | CCATGGGGTTCACCTCCACACTG | No data | ||
Right | 908331411 | 1:63074496-63074518 | GACCGCGCTACCAGCCCGCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
908331411 | Original CRISPR | GACCGCGCTACCAGCCCGCG CGG | Intergenic | ||