ID: 908331414 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:63074508-63074530 |
| Sequence | AGCCCGCGCGGCCTCTGCCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 908331405_908331414 | 22 | Left | 908331405 | 1:63074463-63074485 | CCATGGGGTTCACCTCCACACTG | No data | ||
| Right | 908331414 | 1:63074508-63074530 | AGCCCGCGCGGCCTCTGCCAAGG | No data | ||||
| 908331408_908331414 | 10 | Left | 908331408 | 1:63074475-63074497 | CCTCCACACTGCGGCTGCCAGGA | No data | ||
| Right | 908331414 | 1:63074508-63074530 | AGCCCGCGCGGCCTCTGCCAAGG | No data | ||||
| 908331410_908331414 | -7 | Left | 908331410 | 1:63074492-63074514 | CCAGGACCGCGCTACCAGCCCGC | No data | ||
| Right | 908331414 | 1:63074508-63074530 | AGCCCGCGCGGCCTCTGCCAAGG | No data | ||||
| 908331409_908331414 | 7 | Left | 908331409 | 1:63074478-63074500 | CCACACTGCGGCTGCCAGGACCG | No data | ||
| Right | 908331414 | 1:63074508-63074530 | AGCCCGCGCGGCCTCTGCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 908331414 | Original CRISPR | AGCCCGCGCGGCCTCTGCCA AGG | Intergenic | ||