ID: 908331414

View in Genome Browser
Species Human (GRCh38)
Location 1:63074508-63074530
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908331408_908331414 10 Left 908331408 1:63074475-63074497 CCTCCACACTGCGGCTGCCAGGA No data
Right 908331414 1:63074508-63074530 AGCCCGCGCGGCCTCTGCCAAGG No data
908331409_908331414 7 Left 908331409 1:63074478-63074500 CCACACTGCGGCTGCCAGGACCG No data
Right 908331414 1:63074508-63074530 AGCCCGCGCGGCCTCTGCCAAGG No data
908331410_908331414 -7 Left 908331410 1:63074492-63074514 CCAGGACCGCGCTACCAGCCCGC No data
Right 908331414 1:63074508-63074530 AGCCCGCGCGGCCTCTGCCAAGG No data
908331405_908331414 22 Left 908331405 1:63074463-63074485 CCATGGGGTTCACCTCCACACTG No data
Right 908331414 1:63074508-63074530 AGCCCGCGCGGCCTCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr