ID: 908331415

View in Genome Browser
Species Human (GRCh38)
Location 1:63074509-63074531
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908331410_908331415 -6 Left 908331410 1:63074492-63074514 CCAGGACCGCGCTACCAGCCCGC No data
Right 908331415 1:63074509-63074531 GCCCGCGCGGCCTCTGCCAAGGG No data
908331409_908331415 8 Left 908331409 1:63074478-63074500 CCACACTGCGGCTGCCAGGACCG No data
Right 908331415 1:63074509-63074531 GCCCGCGCGGCCTCTGCCAAGGG No data
908331405_908331415 23 Left 908331405 1:63074463-63074485 CCATGGGGTTCACCTCCACACTG No data
Right 908331415 1:63074509-63074531 GCCCGCGCGGCCTCTGCCAAGGG No data
908331408_908331415 11 Left 908331408 1:63074475-63074497 CCTCCACACTGCGGCTGCCAGGA No data
Right 908331415 1:63074509-63074531 GCCCGCGCGGCCTCTGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type