ID: 908331419 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:63074520-63074542 |
Sequence | CTCTGCCAAGGGCCCGCTGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
908331413_908331419 | -9 | Left | 908331413 | 1:63074506-63074528 | CCAGCCCGCGCGGCCTCTGCCAA | No data | ||
Right | 908331419 | 1:63074520-63074542 | CTCTGCCAAGGGCCCGCTGATGG | No data | ||||
908331408_908331419 | 22 | Left | 908331408 | 1:63074475-63074497 | CCTCCACACTGCGGCTGCCAGGA | No data | ||
Right | 908331419 | 1:63074520-63074542 | CTCTGCCAAGGGCCCGCTGATGG | No data | ||||
908331412_908331419 | -1 | Left | 908331412 | 1:63074498-63074520 | CCGCGCTACCAGCCCGCGCGGCC | No data | ||
Right | 908331419 | 1:63074520-63074542 | CTCTGCCAAGGGCCCGCTGATGG | No data | ||||
908331410_908331419 | 5 | Left | 908331410 | 1:63074492-63074514 | CCAGGACCGCGCTACCAGCCCGC | No data | ||
Right | 908331419 | 1:63074520-63074542 | CTCTGCCAAGGGCCCGCTGATGG | No data | ||||
908331409_908331419 | 19 | Left | 908331409 | 1:63074478-63074500 | CCACACTGCGGCTGCCAGGACCG | No data | ||
Right | 908331419 | 1:63074520-63074542 | CTCTGCCAAGGGCCCGCTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
908331419 | Original CRISPR | CTCTGCCAAGGGCCCGCTGA TGG | Intergenic | ||