ID: 908340055

View in Genome Browser
Species Human (GRCh38)
Location 1:63168916-63168938
Sequence TCACTGCTGTGCACACACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908340055_908340058 0 Left 908340055 1:63168916-63168938 CCCCTGTGTGTGCACAGCAGTGA No data
Right 908340058 1:63168939-63168961 TAAATACAACAATGCATTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908340055 Original CRISPR TCACTGCTGTGCACACACAG GGG (reversed) Intergenic
No off target data available for this crispr