ID: 908342047

View in Genome Browser
Species Human (GRCh38)
Location 1:63191635-63191657
Sequence CTGTCCAAACAGATGGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908342047_908342053 17 Left 908342047 1:63191635-63191657 CCCTTGTCCATCTGTTTGGACAG No data
Right 908342053 1:63191675-63191697 AGTGGTTAGATCCTTGGCAAGGG No data
908342047_908342052 16 Left 908342047 1:63191635-63191657 CCCTTGTCCATCTGTTTGGACAG No data
Right 908342052 1:63191674-63191696 GAGTGGTTAGATCCTTGGCAAGG No data
908342047_908342051 11 Left 908342047 1:63191635-63191657 CCCTTGTCCATCTGTTTGGACAG No data
Right 908342051 1:63191669-63191691 CTTGTGAGTGGTTAGATCCTTGG No data
908342047_908342050 -1 Left 908342047 1:63191635-63191657 CCCTTGTCCATCTGTTTGGACAG No data
Right 908342050 1:63191657-63191679 GCAATGTGTCTGCTTGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908342047 Original CRISPR CTGTCCAAACAGATGGACAA GGG (reversed) Intergenic
No off target data available for this crispr