ID: 908342069

View in Genome Browser
Species Human (GRCh38)
Location 1:63191808-63191830
Sequence GGTATAAGCAAGTATAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908342069_908342078 25 Left 908342069 1:63191808-63191830 CCCCCTCTATACTTGCTTATACC No data
Right 908342078 1:63191856-63191878 GAAGGAAATCAAAACTCAAAAGG No data
908342069_908342074 7 Left 908342069 1:63191808-63191830 CCCCCTCTATACTTGCTTATACC No data
Right 908342074 1:63191838-63191860 ATGTAGATGCCCAAACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908342069 Original CRISPR GGTATAAGCAAGTATAGAGG GGG (reversed) Intergenic
No off target data available for this crispr