ID: 908346009

View in Genome Browser
Species Human (GRCh38)
Location 1:63233831-63233853
Sequence CTCAGGAAACATAATCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908346004_908346009 -4 Left 908346004 1:63233812-63233834 CCCACGTGGCTTGGGAGGCCTCA No data
Right 908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG No data
908346005_908346009 -5 Left 908346005 1:63233813-63233835 CCACGTGGCTTGGGAGGCCTCAG No data
Right 908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908346009 Original CRISPR CTCAGGAAACATAATCATGG AGG Intergenic
No off target data available for this crispr