ID: 908347112

View in Genome Browser
Species Human (GRCh38)
Location 1:63245372-63245394
Sequence GTGAACACTGTGTCCTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908347108_908347112 23 Left 908347108 1:63245326-63245348 CCTTGTTGCTGCATCCTCGCAGA No data
Right 908347112 1:63245372-63245394 GTGAACACTGTGTCCTCACATGG No data
908347109_908347112 9 Left 908347109 1:63245340-63245362 CCTCGCAGAGCAGAAAGCAGAGG No data
Right 908347112 1:63245372-63245394 GTGAACACTGTGTCCTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908347112 Original CRISPR GTGAACACTGTGTCCTCACA TGG Intergenic
No off target data available for this crispr