ID: 908353811

View in Genome Browser
Species Human (GRCh38)
Location 1:63312282-63312304
Sequence CACCGGGACCCCGGAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908353811_908353819 8 Left 908353811 1:63312282-63312304 CCTCCACCTCCGGGGTCCCGGTG No data
Right 908353819 1:63312313-63312335 GCCTCAGCCTCCTGAGTAGCTGG No data
908353811_908353822 10 Left 908353811 1:63312282-63312304 CCTCCACCTCCGGGGTCCCGGTG No data
Right 908353822 1:63312315-63312337 CTCAGCCTCCTGAGTAGCTGGGG No data
908353811_908353821 9 Left 908353811 1:63312282-63312304 CCTCCACCTCCGGGGTCCCGGTG No data
Right 908353821 1:63312314-63312336 CCTCAGCCTCCTGAGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908353811 Original CRISPR CACCGGGACCCCGGAGGTGG AGG (reversed) Intergenic