ID: 908353812

View in Genome Browser
Species Human (GRCh38)
Location 1:63312285-63312307
Sequence AATCACCGGGACCCCGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908353812_908353821 6 Left 908353812 1:63312285-63312307 CCACCTCCGGGGTCCCGGTGATT No data
Right 908353821 1:63312314-63312336 CCTCAGCCTCCTGAGTAGCTGGG No data
908353812_908353822 7 Left 908353812 1:63312285-63312307 CCACCTCCGGGGTCCCGGTGATT No data
Right 908353822 1:63312315-63312337 CTCAGCCTCCTGAGTAGCTGGGG No data
908353812_908353819 5 Left 908353812 1:63312285-63312307 CCACCTCCGGGGTCCCGGTGATT No data
Right 908353819 1:63312313-63312335 GCCTCAGCCTCCTGAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908353812 Original CRISPR AATCACCGGGACCCCGGAGG TGG (reversed) Intergenic