ID: 908353812 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:63312285-63312307 |
| Sequence | AATCACCGGGACCCCGGAGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 908353812_908353821 | 6 | Left | 908353812 | 1:63312285-63312307 | CCACCTCCGGGGTCCCGGTGATT | No data | ||
| Right | 908353821 | 1:63312314-63312336 | CCTCAGCCTCCTGAGTAGCTGGG | No data | ||||
| 908353812_908353822 | 7 | Left | 908353812 | 1:63312285-63312307 | CCACCTCCGGGGTCCCGGTGATT | No data | ||
| Right | 908353822 | 1:63312315-63312337 | CTCAGCCTCCTGAGTAGCTGGGG | No data | ||||
| 908353812_908353819 | 5 | Left | 908353812 | 1:63312285-63312307 | CCACCTCCGGGGTCCCGGTGATT | No data | ||
| Right | 908353819 | 1:63312313-63312335 | GCCTCAGCCTCCTGAGTAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 908353812 | Original CRISPR | AATCACCGGGACCCCGGAGG TGG (reversed) | Intergenic | ||