ID: 908353813

View in Genome Browser
Species Human (GRCh38)
Location 1:63312288-63312310
Sequence GAGAATCACCGGGACCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908353813_908353819 2 Left 908353813 1:63312288-63312310 CCTCCGGGGTCCCGGTGATTCTC No data
Right 908353819 1:63312313-63312335 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
908353813_908353822 4 Left 908353813 1:63312288-63312310 CCTCCGGGGTCCCGGTGATTCTC No data
Right 908353822 1:63312315-63312337 CTCAGCCTCCTGAGTAGCTGGGG 0: 2097
1: 4231
2: 5385
3: 4345
4: 3316
908353813_908353821 3 Left 908353813 1:63312288-63312310 CCTCCGGGGTCCCGGTGATTCTC No data
Right 908353821 1:63312314-63312336 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908353813 Original CRISPR GAGAATCACCGGGACCCCGG AGG (reversed) Intergenic
No off target data available for this crispr