ID: 908353814

View in Genome Browser
Species Human (GRCh38)
Location 1:63312291-63312313
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908353814_908353819 -1 Left 908353814 1:63312291-63312313 CCGGGGTCCCGGTGATTCTCCCG No data
Right 908353819 1:63312313-63312335 GCCTCAGCCTCCTGAGTAGCTGG No data
908353814_908353821 0 Left 908353814 1:63312291-63312313 CCGGGGTCCCGGTGATTCTCCCG No data
Right 908353821 1:63312314-63312336 CCTCAGCCTCCTGAGTAGCTGGG No data
908353814_908353822 1 Left 908353814 1:63312291-63312313 CCGGGGTCCCGGTGATTCTCCCG No data
Right 908353822 1:63312315-63312337 CTCAGCCTCCTGAGTAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908353814 Original CRISPR CGGGAGAATCACCGGGACCC CGG (reversed) Intergenic