ID: 908353819

View in Genome Browser
Species Human (GRCh38)
Location 1:63312313-63312335
Sequence GCCTCAGCCTCCTGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 757156
Summary {0: 84870, 1: 190808, 2: 228673, 3: 158767, 4: 94038}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908353813_908353819 2 Left 908353813 1:63312288-63312310 CCTCCGGGGTCCCGGTGATTCTC No data
Right 908353819 1:63312313-63312335 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
908353812_908353819 5 Left 908353812 1:63312285-63312307 CCACCTCCGGGGTCCCGGTGATT No data
Right 908353819 1:63312313-63312335 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
908353811_908353819 8 Left 908353811 1:63312282-63312304 CCTCCACCTCCGGGGTCCCGGTG No data
Right 908353819 1:63312313-63312335 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
908353816_908353819 -9 Left 908353816 1:63312299-63312321 CCGGTGATTCTCCCGCCTCAGCC 0: 41
1: 1499
2: 4159
3: 6906
4: 7017
Right 908353819 1:63312313-63312335 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
908353814_908353819 -1 Left 908353814 1:63312291-63312313 CCGGGGTCCCGGTGATTCTCCCG No data
Right 908353819 1:63312313-63312335 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
908353815_908353819 -8 Left 908353815 1:63312298-63312320 CCCGGTGATTCTCCCGCCTCAGC No data
Right 908353819 1:63312313-63312335 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908353819 Original CRISPR GCCTCAGCCTCCTGAGTAGC TGG Intergenic
Too many off-targets to display for this crispr