ID: 908353821

View in Genome Browser
Species Human (GRCh38)
Location 1:63312314-63312336
Sequence CCTCAGCCTCCTGAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 777919
Summary {0: 96881, 1: 202886, 2: 238913, 3: 154169, 4: 85070}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908353815_908353821 -7 Left 908353815 1:63312298-63312320 CCCGGTGATTCTCCCGCCTCAGC No data
Right 908353821 1:63312314-63312336 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
908353813_908353821 3 Left 908353813 1:63312288-63312310 CCTCCGGGGTCCCGGTGATTCTC No data
Right 908353821 1:63312314-63312336 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
908353811_908353821 9 Left 908353811 1:63312282-63312304 CCTCCACCTCCGGGGTCCCGGTG No data
Right 908353821 1:63312314-63312336 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
908353812_908353821 6 Left 908353812 1:63312285-63312307 CCACCTCCGGGGTCCCGGTGATT No data
Right 908353821 1:63312314-63312336 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
908353816_908353821 -8 Left 908353816 1:63312299-63312321 CCGGTGATTCTCCCGCCTCAGCC 0: 41
1: 1499
2: 4159
3: 6906
4: 7017
Right 908353821 1:63312314-63312336 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
908353814_908353821 0 Left 908353814 1:63312291-63312313 CCGGGGTCCCGGTGATTCTCCCG No data
Right 908353821 1:63312314-63312336 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908353821 Original CRISPR CCTCAGCCTCCTGAGTAGCT GGG Intergenic
Too many off-targets to display for this crispr