ID: 908353822

View in Genome Browser
Species Human (GRCh38)
Location 1:63312315-63312337
Sequence CTCAGCCTCCTGAGTAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908353811_908353822 10 Left 908353811 1:63312282-63312304 CCTCCACCTCCGGGGTCCCGGTG No data
Right 908353822 1:63312315-63312337 CTCAGCCTCCTGAGTAGCTGGGG No data
908353814_908353822 1 Left 908353814 1:63312291-63312313 CCGGGGTCCCGGTGATTCTCCCG No data
Right 908353822 1:63312315-63312337 CTCAGCCTCCTGAGTAGCTGGGG No data
908353816_908353822 -7 Left 908353816 1:63312299-63312321 CCGGTGATTCTCCCGCCTCAGCC No data
Right 908353822 1:63312315-63312337 CTCAGCCTCCTGAGTAGCTGGGG No data
908353812_908353822 7 Left 908353812 1:63312285-63312307 CCACCTCCGGGGTCCCGGTGATT No data
Right 908353822 1:63312315-63312337 CTCAGCCTCCTGAGTAGCTGGGG No data
908353813_908353822 4 Left 908353813 1:63312288-63312310 CCTCCGGGGTCCCGGTGATTCTC No data
Right 908353822 1:63312315-63312337 CTCAGCCTCCTGAGTAGCTGGGG No data
908353815_908353822 -6 Left 908353815 1:63312298-63312320 CCCGGTGATTCTCCCGCCTCAGC No data
Right 908353822 1:63312315-63312337 CTCAGCCTCCTGAGTAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908353822 Original CRISPR CTCAGCCTCCTGAGTAGCTG GGG Intergenic