ID: 908356699

View in Genome Browser
Species Human (GRCh38)
Location 1:63329816-63329838
Sequence TTCTTGCCTCGTGATGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908356688_908356699 19 Left 908356688 1:63329774-63329796 CCGGCGATGAGTGGTTCTGCGGG No data
Right 908356699 1:63329816-63329838 TTCTTGCCTCGTGATGTGGGAGG No data
908356692_908356699 -6 Left 908356692 1:63329799-63329821 CCGACGGCCCCATTTCCTTCTTG No data
Right 908356699 1:63329816-63329838 TTCTTGCCTCGTGATGTGGGAGG No data
908356685_908356699 27 Left 908356685 1:63329766-63329788 CCTCTAGCCCGGCGATGAGTGGT No data
Right 908356699 1:63329816-63329838 TTCTTGCCTCGTGATGTGGGAGG No data
908356686_908356699 20 Left 908356686 1:63329773-63329795 CCCGGCGATGAGTGGTTCTGCGG No data
Right 908356699 1:63329816-63329838 TTCTTGCCTCGTGATGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908356699 Original CRISPR TTCTTGCCTCGTGATGTGGG AGG Intergenic
No off target data available for this crispr