ID: 908358587

View in Genome Browser
Species Human (GRCh38)
Location 1:63345973-63345995
Sequence CTCCACAGAGCCACTCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908358580_908358587 8 Left 908358580 1:63345942-63345964 CCTCCTCAGTTGTTGTGATTCTG No data
Right 908358587 1:63345973-63345995 CTCCACAGAGCCACTCTAGGAGG No data
908358583_908358587 5 Left 908358583 1:63345945-63345967 CCTCAGTTGTTGTGATTCTGGGG No data
Right 908358587 1:63345973-63345995 CTCCACAGAGCCACTCTAGGAGG No data
908358579_908358587 15 Left 908358579 1:63345935-63345957 CCTTTCTCCTCCTCAGTTGTTGT No data
Right 908358587 1:63345973-63345995 CTCCACAGAGCCACTCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908358587 Original CRISPR CTCCACAGAGCCACTCTAGG AGG Intergenic
No off target data available for this crispr