ID: 908360053

View in Genome Browser
Species Human (GRCh38)
Location 1:63359993-63360015
Sequence GCTGAGGTTCAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 528}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908360053_908360060 5 Left 908360053 1:63359993-63360015 CCCTCCTCCTTCTGAACCTCAGC 0: 1
1: 0
2: 6
3: 50
4: 528
Right 908360060 1:63360021-63360043 CTCCACTGTGCCAATCTGGATGG 0: 1
1: 0
2: 0
3: 18
4: 157
908360053_908360058 1 Left 908360053 1:63359993-63360015 CCCTCCTCCTTCTGAACCTCAGC 0: 1
1: 0
2: 6
3: 50
4: 528
Right 908360058 1:63360017-63360039 CTGCCTCCACTGTGCCAATCTGG 0: 1
1: 0
2: 1
3: 23
4: 224
908360053_908360063 15 Left 908360053 1:63359993-63360015 CCCTCCTCCTTCTGAACCTCAGC 0: 1
1: 0
2: 6
3: 50
4: 528
Right 908360063 1:63360031-63360053 CCAATCTGGATGGTGCATCAAGG 0: 1
1: 0
2: 3
3: 14
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908360053 Original CRISPR GCTGAGGTTCAGAAGGAGGA GGG (reversed) Intergenic
900427624 1:2587645-2587667 ACAGAGGGTCGGAAGGAGGAGGG + Intronic
900720130 1:4170553-4170575 GCTGAGGGTGAGACCGAGGAAGG + Intergenic
901626739 1:10629198-10629220 GCTGAGGATCAGAAGGAAGCAGG + Intronic
902196662 1:14803460-14803482 CATCAGGGTCAGAAGGAGGATGG - Intronic
903288478 1:22291963-22291985 GGTGAGGCTCAGAAGGAGACAGG + Intergenic
903453336 1:23470136-23470158 ACTGAGGCATAGAAGGAGGAAGG - Intronic
903571376 1:24308122-24308144 GCTGAGGTTCTGAAGTAACAGGG + Intergenic
903671329 1:25037538-25037560 ACTGAGGTTCAGAAAGGGAAAGG + Intergenic
903950045 1:26991436-26991458 GCTGGGGCTCAGTAGGGGGAAGG - Intergenic
904361592 1:29976729-29976751 ACTGAGGTTCAGAGAGGGGAAGG - Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
904804592 1:33121816-33121838 GCTGAGATACTGAAGCAGGATGG - Intergenic
904961141 1:34333946-34333968 GCTGAGGTCCAGAAGGCAGTGGG - Intergenic
904968609 1:34401041-34401063 GCTGAGCTTCACCACGAGGATGG + Intergenic
905109835 1:35587260-35587282 CCTGAGGCTAAGCAGGAGGATGG + Intronic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905866060 1:41377426-41377448 GCCCAGGTTCTGAAGGAGAACGG + Intronic
906145449 1:43557820-43557842 GCTATGTTTCAGAAGCAGGAGGG - Intronic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906646301 1:47477988-47478010 ACTGAGGGTCAGAAAGGGGAAGG - Intergenic
906692481 1:47801686-47801708 TCTGAAGTCCAGAGGGAGGAGGG - Intronic
907220603 1:52904698-52904720 GCTGTGGCCCAGAACGAGGAGGG - Exonic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
909561873 1:77016301-77016323 GAAGAGTTTCAGGAGGAGGAGGG - Intronic
909939342 1:81592501-81592523 GCTGAGATTCGGGAGGTGGATGG - Intronic
910715137 1:90222410-90222432 GGTGAGGCTCTGAGGGAGGAAGG + Intergenic
911407619 1:97462545-97462567 CCTGAATTTCAAAAGGAGGAGGG - Intronic
912274272 1:108240167-108240189 GCTGAAGTTCAGAGAGAGGCTGG - Intronic
912286995 1:108379695-108379717 GCTGAAGTTCAGAGAGAGGCTGG + Intronic
912293947 1:108454156-108454178 GCTGAAGTTCAGAGAGAGGCTGG + Intronic
912753938 1:112308814-112308836 GCTGGGGTTCATAAGGGGAAGGG + Intergenic
912841603 1:113043993-113044015 GCTGAGGTGGAGTAGGGGGAGGG + Intergenic
913157657 1:116115812-116115834 GCTGTGGTTAAGGAGGAGGAGGG + Intronic
913184679 1:116359224-116359246 GCTGAGATTCAGAGGGATTATGG - Intergenic
915514659 1:156405851-156405873 GAAGAGTTTCAGAAAGAGGAGGG + Intronic
915594548 1:156888655-156888677 GCTGAGGGTGAGCAGGAGGCTGG - Intergenic
917491408 1:175501683-175501705 GATGAAGTTAAGAAGAAGGAAGG - Intronic
918796778 1:188908993-188909015 ACTGAGGTTCAGAAAGAAAATGG + Intergenic
919833066 1:201555661-201555683 AGTGAGGCTCAGAAGGAGGGAGG + Intergenic
920341898 1:205280357-205280379 GCTGAGGCTCAGAAGGATGAAGG + Intergenic
922026025 1:221749780-221749802 ACTGAGTTTCAGGAGGATGAAGG + Intergenic
922026418 1:221753832-221753854 ACTGAGGCTCAGAAAGAGTAAGG - Intergenic
922061760 1:222099384-222099406 GCCCAGGTTCAGAAGGAGGCAGG + Intergenic
922914929 1:229249455-229249477 GCTGAGGTGCAGATGCACGAAGG - Intergenic
924676564 1:246184472-246184494 TCTGAGGTACAGATTGAGGATGG - Intronic
1062947291 10:1471257-1471279 GTGGAGCTTCAGAAGGAGAACGG - Intronic
1063462341 10:6222715-6222737 GCAGTGGTTGAGAAGGAGCAGGG - Intronic
1063610939 10:7561509-7561531 GCTGAGGTTGGGAAGACGGAAGG + Exonic
1063652479 10:7951815-7951837 ACTGAAGTTCAGAAGGATGAAGG + Intronic
1064909896 10:20388905-20388927 GATGAGGTTAGGAAAGAGGAAGG + Intergenic
1065115908 10:22482207-22482229 CCTCAGGATCAAAAGGAGGAGGG + Intergenic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1065812612 10:29456131-29456153 CCTGAGGGTCAGAAAGAGGCAGG - Intergenic
1067031661 10:42882192-42882214 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1067279519 10:44860805-44860827 ACTGAGATTCAGAAAGAGAAAGG - Intergenic
1067560330 10:47300607-47300629 GCCGAAGTCCAGGAGGAGGAAGG - Exonic
1067991467 10:51217930-51217952 CCTGAGATTCAGATGAAGGAGGG - Intronic
1070416708 10:76197306-76197328 GCAGAAGGTCAGATGGAGGAAGG - Intronic
1070969998 10:80555597-80555619 GCTGAGGTCATGGAGGAGGAGGG + Intronic
1071478993 10:86048875-86048897 ACTGAGCTTCAGAAAGGGGAAGG - Intronic
1072100741 10:92226919-92226941 GCTGCAGTTCTGAAGGGGGAGGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072442745 10:95471414-95471436 GCTGAGGTTAGGGTGGAGGAGGG + Intronic
1072532450 10:96332070-96332092 GCTGAGGTTCAGAAGTGGAGAGG + Intronic
1073267258 10:102235194-102235216 GCTGAGGTTCAGAGGGGCCAGGG - Intronic
1073692449 10:105825159-105825181 CCTTGGGTTAAGAAGGAGGAGGG + Intergenic
1073930971 10:108576342-108576364 TCTGAGGTACATGAGGAGGATGG + Intergenic
1074400712 10:113139284-113139306 GCTGAGGTGGAGAAGGAAAAGGG - Intronic
1075078082 10:119364568-119364590 GCTGGGGTACAGCAGGAGGGAGG - Intronic
1075091101 10:119444558-119444580 GCTGGGGACCATAAGGAGGAGGG - Intronic
1075297546 10:121291607-121291629 GCTGTGGCTCTGAAGTAGGAGGG - Intergenic
1075306103 10:121368764-121368786 GTTGAGGTGCAGAAGTGGGAAGG - Intergenic
1076131123 10:128014708-128014730 GCTGGGGTTGAGACGGGGGATGG - Intronic
1076756852 10:132577092-132577114 GCTGAGGCTCAGCAGAATGAAGG + Intronic
1077102567 11:828635-828657 GATGAGGCCCAGGAGGAGGAGGG + Exonic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1078665019 11:13316914-13316936 GCTGATGTTCTGAAGCAGGTGGG - Intronic
1078895283 11:15592020-15592042 GCTGGGCTTCACATGGAGGAAGG + Intergenic
1079518580 11:21297881-21297903 GATGAGGGACAGAAGGAGGGAGG + Intronic
1081651778 11:44828705-44828727 GCTGGGCTACAGAAGGGGGAAGG - Intronic
1081751150 11:45512084-45512106 GCTGAGGCCCAGAAAAAGGAAGG + Intergenic
1082820704 11:57542916-57542938 GCTGAACTTAAAAAGGAGGATGG + Exonic
1083176356 11:60952307-60952329 GCAGAGGTAGAGAAGGAGGGAGG - Intronic
1084058460 11:66653279-66653301 GCTGAGGAAAAGTAGGAGGAGGG - Intronic
1084430499 11:69108182-69108204 GCTGAGTTTCACAACGGGGAGGG - Intergenic
1085055227 11:73399319-73399341 GCTGAGGGCCAGGAGCAGGAGGG - Intergenic
1087133848 11:94694641-94694663 GCTGAGTTTTAGCAGCAGGAGGG - Intergenic
1087672966 11:101128394-101128416 GTGGAGGTTGAGGAGGAGGATGG - Exonic
1088412213 11:109546964-109546986 GTAGAGGTTCAGAATGGGGAAGG + Intergenic
1088510126 11:110565536-110565558 TCTGAGGTTAAGAAAGATGAAGG - Intergenic
1089140365 11:116279350-116279372 GCTGAGGTTCTTAGGGAGGATGG - Intergenic
1089360878 11:117885655-117885677 GCTGAGGCACAGAGGTAGGAAGG + Intergenic
1089387602 11:118078488-118078510 GCTGATGATCAGAAAGGGGAAGG + Intronic
1089497516 11:118915209-118915231 GCTGAGGCTCAGAGGGATAAAGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090620185 11:128553695-128553717 GCTGAGGAGGAGGAGGAGGAGGG - Intronic
1091108970 11:132947657-132947679 GCTGAGGTTCACAATGAACAAGG + Intronic
1091215071 11:133896057-133896079 GCTGACGTACAGAAGGAAGGAGG - Intergenic
1091301818 11:134512772-134512794 GAAGAGGTACAGATGGAGGAGGG - Intergenic
1091347514 11:134864963-134864985 GCTGAGGCTCTGAAGGTGGTGGG + Intergenic
1091805144 12:3350547-3350569 GCTGAGGTTCAGCAGAGGGTGGG + Intergenic
1091853908 12:3723620-3723642 GCTGAGGTTAGGGAGCAGGATGG - Intronic
1092260839 12:6952545-6952567 GGTGAGGGGCAGACGGAGGAAGG - Intronic
1092276900 12:7068352-7068374 GCTGAGGTTCTGAAGGAACGGGG + Intronic
1092987611 12:13861656-13861678 GCTGAGGCTCACAAGTAGTATGG - Intronic
1093709891 12:22318568-22318590 GCTTAGCTTGAGAAGGAGGCAGG - Intronic
1093773425 12:23044018-23044040 GCAGAGGTTCACAAGCTGGATGG - Intergenic
1096000338 12:48124564-48124586 GCTCAGGATCAGAAGGTGGAAGG - Intronic
1096001795 12:48136189-48136211 CCAGAGGTTAAGAATGAGGAGGG - Intronic
1096515688 12:52153944-52153966 ACTGAGGTCCAGAGAGAGGAAGG - Intergenic
1098250298 12:68561994-68562016 ACTGAGGTTCAGAAAGATTAAGG + Intergenic
1098562341 12:71888733-71888755 GCTGAGATTGAGAAAGAGTAGGG - Intronic
1098685683 12:73417053-73417075 GTTGAGGATGAGAAGGTGGAGGG + Intergenic
1099009304 12:77272723-77272745 TCTGGGTTTCAGAAGGAGCAAGG + Intergenic
1099278704 12:80613665-80613687 CATTAGGTTGAGAAGGAGGAAGG - Exonic
1100766744 12:97874600-97874622 GCTGAGGAGGAGAAAGAGGAAGG - Intergenic
1101040843 12:100753938-100753960 TCTGTGTTTCAGAAGCAGGATGG - Intronic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1101836204 12:108297155-108297177 GCTGAGGAACAGGAAGAGGAGGG - Intronic
1101843208 12:108342294-108342316 GGAGGGGGTCAGAAGGAGGAAGG + Intergenic
1102797302 12:115699983-115700005 ACTGAGGCTCAGAAGGACAAAGG + Intergenic
1102914745 12:116744485-116744507 GCTGAGGCTCAGAGAGGGGAAGG + Intronic
1103273384 12:119691467-119691489 GCAGATGCTCAGAAGGTGGATGG + Intronic
1104232325 12:126897381-126897403 TCTGAGGTTACAAAGGAGGATGG + Intergenic
1104406143 12:128518460-128518482 GTTGTAGTTCAGAAGGAAGAAGG + Intronic
1104428523 12:128697431-128697453 CCAGAGGTTCAGAGGGAGCAGGG + Intronic
1104526796 12:129531695-129531717 GCTGAGGTTCAGATAGGGGAAGG + Intronic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1105008111 12:132735750-132735772 TGTGAGGTTCAGAACCAGGAGGG + Intronic
1105508787 13:21034214-21034236 CCTGAGGCTCAGAAGGTGCATGG + Intronic
1105775918 13:23659964-23659986 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
1106078757 13:26483513-26483535 ACAGAGGTTCAGAAGCAGGCAGG - Intergenic
1106351717 13:28937075-28937097 AGTGATGCTCAGAAGGAGGAGGG + Intronic
1106415615 13:29543678-29543700 TCAGAGGTTCCGCAGGAGGAGGG + Intronic
1108914273 13:55588607-55588629 GCTGGGGGAGAGAAGGAGGATGG + Intergenic
1110324307 13:74196321-74196343 GCAGGAGATCAGAAGGAGGAGGG + Intergenic
1111302546 13:86364243-86364265 GCTGAAGTTCAGAAGAAAGGTGG - Intergenic
1111598951 13:90447175-90447197 GCTGGAGTGGAGAAGGAGGATGG - Intergenic
1112421541 13:99255039-99255061 GCTGAGGTTCATGAGGAAGGTGG + Exonic
1113029595 13:105978416-105978438 GCTGAGATTCAGAGACAGGAGGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113912952 13:113852898-113852920 GCTGTGGTTCAGAACAAGGTGGG + Intronic
1114237451 14:20835194-20835216 GCTGAGGGTTTGAAGGGGGAAGG + Intergenic
1114258303 14:21020582-21020604 GCTGAGGGACAGCAGAAGGAAGG + Exonic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1116665124 14:47764850-47764872 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1118325419 14:64777295-64777317 GCTGAGTTTCAGAAGCAGGCAGG + Intronic
1118388987 14:65280691-65280713 GCTCTGGTTCAGATGGCGGACGG + Intergenic
1118758545 14:68863468-68863490 GCAGAGGTGCAGAAGATGGAAGG + Intergenic
1119055710 14:71417643-71417665 GCAGAGGTGGAGGAGGAGGAAGG + Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119601686 14:75980952-75980974 GCAGACGTGCAGAAGGAGGGAGG + Exonic
1119883036 14:78116649-78116671 GATGAGGATAAGGAGGAGGAGGG - Intergenic
1119978972 14:79058204-79058226 GCTGAGGTTCAAACTGAGGTTGG + Intronic
1120779764 14:88476643-88476665 GCTGAGGTTCTGACGCATGAAGG + Intronic
1120853136 14:89188608-89188630 GCTGAAGTTCAGAGGGAAAATGG - Intronic
1121256275 14:92532572-92532594 GCTGAGGCTGAGAAGGGAGAGGG - Intronic
1121343847 14:93120833-93120855 TCTGGGGATCAGGAGGAGGAAGG + Intergenic
1122150242 14:99721754-99721776 ACTGAGGTCCAGAAGGAGAAGGG - Intronic
1122292755 14:100688366-100688388 GCGGAGCTTCAGGAGGAGGGAGG - Intergenic
1123821920 15:24038887-24038909 GCTGAGGCTCAGTTGGAGAAGGG + Intergenic
1124027641 15:25981713-25981735 ACTGAGGTACGGAAGGAGGGAGG + Intergenic
1124346389 15:28924174-28924196 CCTGAGGTTGAGAACAAGGAGGG - Intronic
1124611548 15:31213167-31213189 GCTGGAGTTTACAAGGAGGAAGG + Intergenic
1125594566 15:40876070-40876092 GCAGAGGTGGAGAAGGTGGAAGG + Intergenic
1125931509 15:43603403-43603425 GCACAGGTTCTGAAGGGGGAAGG + Exonic
1125944607 15:43702913-43702935 GCACAGGTTCTGAAGGGGGAAGG + Intergenic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1127982324 15:64044519-64044541 GCTGAGATCCAGAAAGGGGAAGG + Intronic
1128284644 15:66426558-66426580 TCTGGGGTTCAGGAAGAGGAAGG + Intronic
1128363721 15:66982047-66982069 GCTGAGGTTCACAAAGACGCTGG + Intergenic
1128515845 15:68341455-68341477 GTTGAGGTTCAGAGGGGGAAGGG + Intronic
1128531116 15:68448691-68448713 GCTGAGGCTCAGATAGGGGAAGG - Intergenic
1128556937 15:68638183-68638205 GCTGAGGGTCAGGAGGAGGGAGG - Intronic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1129382609 15:75177686-75177708 GCTGAGGCTCAGAGAGAGCAGGG - Intergenic
1130126272 15:81096726-81096748 TGTGAGTTTCAGAAGCAGGAAGG - Intronic
1130172126 15:81525743-81525765 GCTGGGTCTCAGATGGAGGAAGG + Intergenic
1130819547 15:87479919-87479941 GCTCAGCTACAGAAGGAGCAGGG - Intergenic
1130986115 15:88845741-88845763 GCTGAGGTTGAGAATGAGACTGG + Exonic
1131140366 15:89972242-89972264 GCTGAGCCTCAGAAGAAGGAAGG - Intergenic
1131604317 15:93884932-93884954 GCTGAGGTCCAGAAGGTGAATGG - Intergenic
1131843962 15:96469164-96469186 CCTGAGATTCAGAAAGAGGGTGG + Intergenic
1132153133 15:99476222-99476244 GCTGATCTTCTAAAGGAGGAGGG - Intergenic
1132650437 16:1019115-1019137 GCTGGGCTCCAAAAGGAGGAGGG - Intergenic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1133280532 16:4662674-4662696 GCCGAGGCTCGGAGGGAGGAGGG + Intronic
1133829924 16:9311899-9311921 CCTGAGGTTCAGAAAGGTGAAGG - Intergenic
1134693014 16:16203457-16203479 GCTGAGGGTCCCCAGGAGGAAGG + Exonic
1134978833 16:18591238-18591260 GCTGAGGGTCCCCAGGAGGAAGG - Intergenic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1136230211 16:28881228-28881250 ACTGAGGCTCAGAGGGATGAAGG - Intronic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1137253439 16:46756972-46756994 GGTGAGGGGCAGGAGGAGGAAGG + Intronic
1137791002 16:51174672-51174694 GCAGAGGTTCAGGAGCAGAAAGG - Intergenic
1137820626 16:51441295-51441317 GCTAAGGATCAGAAGAAAGAGGG + Intergenic
1138394066 16:56690977-56690999 GCAGAGGCTCAGAAGAGGGAGGG - Intronic
1138615756 16:58164722-58164744 GCTGAGGTCTAGAAGGCTGAAGG + Intronic
1139282970 16:65785555-65785577 GCAGAGGTTCAGAATAATGAAGG - Intergenic
1139322155 16:66123608-66123630 GAGGAGGTTGAGAGGGAGGAAGG + Intergenic
1139459338 16:67109554-67109576 GCTGAGGCCCAGCAGGAGGGAGG - Intergenic
1139790848 16:69433529-69433551 GCTGTGGTGAAGGAGGAGGAGGG - Intronic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140307143 16:73813743-73813765 TCTGAGGTACAGGAAGAGGAGGG - Intergenic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142995355 17:3756866-3756888 GCTGAGGTTCAGGGAGATGATGG + Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143373345 17:6453948-6453970 GCCAAGGTTCAGCAGCAGGAGGG + Exonic
1143498081 17:7323764-7323786 GCTGAGGCTGGGCAGGAGGAAGG + Intronic
1143542596 17:7578533-7578555 GCTGAGGAGCAGCAGGAGGGGGG + Exonic
1145312416 17:21707885-21707907 GCAGAGGGTCAGGAGCAGGAGGG - Intergenic
1145786571 17:27597623-27597645 ACTGAGGTTCAGAGAGAGGGAGG + Intronic
1146267541 17:31462960-31462982 GCTGAGGCTCAGGATCAGGAGGG - Intronic
1146570770 17:33950654-33950676 GCTGAAGTTCAGAGAGGGGAAGG + Intronic
1146670918 17:34736873-34736895 GCTGGGGTTCAGAAGCCCGAGGG - Intergenic
1147110343 17:38257063-38257085 GCTGAAGACGAGAAGGAGGAGGG + Intergenic
1147614487 17:41820147-41820169 CCTGAGGATCCAAAGGAGGATGG - Intronic
1147668568 17:42163833-42163855 GCTGAGGTTGGGCAGCAGGAGGG + Exonic
1147898412 17:43767557-43767579 ACTGAGGTTCAGAATGATTAAGG - Exonic
1148189337 17:45667729-45667751 ACAGAGGTAGAGAAGGAGGATGG - Intergenic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1148419167 17:47531368-47531390 GCTGAAGACGAGAAGGAGGAGGG - Exonic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1148917702 17:50996611-50996633 GCACATGTTCAGAAGGAAGACGG - Exonic
1149592450 17:57841482-57841504 GCTGGGGTGCAGAAGTGGGAGGG - Intronic
1149808509 17:59642195-59642217 TCTGAAGTTGAGAAGTAGGAAGG + Intronic
1149866281 17:60152694-60152716 GCAGAGGTCTTGAAGGAGGAAGG - Intronic
1150006680 17:61474119-61474141 GGGGAGGATCAGAAGGATGATGG + Intronic
1150388957 17:64780129-64780151 GCTGAGGGACCGAAGGAGCAGGG + Intergenic
1150790489 17:68197791-68197813 GCTGAGGGACTGAAGGAGCAGGG - Intergenic
1151554569 17:74840201-74840223 GGTGAGGTACAGAAAGAGGGAGG - Intergenic
1151566983 17:74904228-74904250 ACTGAGGTTCAGGTGGGGGATGG - Intergenic
1151781945 17:76252558-76252580 GCTGTGTTTCTGAAGGAGAAGGG + Intergenic
1151963875 17:77421240-77421262 GCTGAGGGACTGAAGGAAGAGGG - Intronic
1152209705 17:78996514-78996536 GCTGGGGTTCAGGGAGAGGAGGG + Intronic
1153416037 18:4846651-4846673 GCTGAGTTGCAGAAGGAAGCAGG - Intergenic
1154360225 18:13654561-13654583 GCTTAGCTTCAGAAGTTGGAGGG - Intergenic
1155517393 18:26637266-26637288 CCCGGGGTTCAGAAGGAGCATGG - Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155958109 18:31970964-31970986 TCTGACTTTCAGAAGGAGGATGG - Intergenic
1157190893 18:45580769-45580791 GCTGAGATTCAGACTGAGGCTGG + Intronic
1157429109 18:47608843-47608865 GCTGAGGTGTATAAGGAAGAAGG + Intergenic
1157683206 18:49622971-49622993 ACTGAGGTTCTGAGAGAGGATGG - Intergenic
1157741254 18:50095497-50095519 GCTGGGGTTCAGAATGAGAGTGG + Intronic
1157957457 18:52114390-52114412 GCTCAGGCAAAGAAGGAGGAAGG + Intergenic
1159631844 18:70758141-70758163 GCTAGAGTTCAGAAAGAGGAGGG - Intergenic
1160652480 19:238411-238433 GTTGAGGTTAAGCAGGAAGAAGG - Intergenic
1161021058 19:2011750-2011772 GCTGAGGAGCAGGAGCAGGAGGG - Intronic
1161686263 19:5704161-5704183 GCTGTGGCTGTGAAGGAGGAAGG + Intronic
1161775673 19:6260876-6260898 TCTGAGGTTCAGAAGCAGTTTGG - Intronic
1161836308 19:6649429-6649451 GCAGAGGCTCTGAAGCAGGAAGG - Intergenic
1161855586 19:6763021-6763043 ACTGAGTTTCAGATGGAGGTGGG + Intronic
1162134119 19:8544693-8544715 GCTGAGGTGCAGAAGTGGGTGGG + Intronic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1163013515 19:14440247-14440269 GCTGAGGTTCAGGAAGAGGGCGG + Exonic
1163779560 19:19239405-19239427 GAAGAGGTATAGAAGGAGGAGGG - Intronic
1164684717 19:30159096-30159118 GCTGAGGTTCAGAGGAGGGAGGG - Intergenic
1164767597 19:30783764-30783786 GCTGAAGTTCAGAGGGAGGAAGG + Intergenic
1165314780 19:35048116-35048138 GCTGAGGCTCAGAGAGGGGAGGG + Intronic
1165938401 19:39403202-39403224 CCTGAGGATCTGAGGGAGGAGGG + Intergenic
1166114224 19:40642957-40642979 GCTGAGGCTCAGAGAGAGGAAGG + Intergenic
1166679748 19:44759201-44759223 GCCGGGGGTCAGAAGGAGGAGGG - Intronic
1166683792 19:44782976-44782998 GCTGAGGTGCAGGGGTAGGACGG + Intronic
1166797506 19:45436160-45436182 ACTGAGGCTCAGAGAGAGGATGG - Intronic
1166866181 19:45838799-45838821 TCTGAGGTTCAGAACGAGTCAGG - Intronic
1167203138 19:48081421-48081443 TCAGAGATTCAGAAAGAGGAGGG + Intronic
1167259703 19:48451386-48451408 ACTGAGGCTCAGCAAGAGGAAGG + Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1168276851 19:55283715-55283737 GCTGAGGCAGAGAGGGAGGAAGG - Intronic
925083293 2:1087056-1087078 GCTAAGGAGCAGAAGGAGGGTGG + Intronic
925180273 2:1813098-1813120 GCGGAGGTTCAGACGGCGGAAGG - Intronic
925662017 2:6212773-6212795 GCTGCGGTGCTGAAGGAGCATGG - Intergenic
925769158 2:7265516-7265538 GCTCAGTGTCAGGAGGAGGAGGG + Intergenic
926123581 2:10257741-10257763 TCTGAGTTTCAGGAGGAGCAGGG - Intergenic
926278148 2:11421593-11421615 GCTGAGGCTCAGGAGGATGAGGG - Intergenic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927469939 2:23366158-23366180 TCAGAGGCTCAGAAGGGGGAGGG + Intergenic
927732671 2:25488398-25488420 TCTGAGGTTGGAAAGGAGGAGGG + Intronic
927803572 2:26123961-26123983 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
928409406 2:31042940-31042962 GCTTAGGTTCAGAAGGAAATGGG - Intronic
930141397 2:47954438-47954460 TTTCAGGTCCAGAAGGAGGAGGG - Intergenic
930686333 2:54312472-54312494 ACTGAGGTACAGATGGAGGTAGG - Intergenic
931161012 2:59690571-59690593 GATGATGTTAATAAGGAGGATGG + Intergenic
931345092 2:61439273-61439295 GCTGAGGCACAGCAGGAGGAGGG - Intronic
932922589 2:75934136-75934158 AATGAGGTTCAGAATGATGATGG - Intergenic
933857283 2:86428215-86428237 GCTGAGGTGCAGAAAGAGAGAGG - Intergenic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935697889 2:105785773-105785795 TCTGAGGGTCAGCAGGAGGTTGG + Intronic
936104321 2:109612288-109612310 TCTGGGGTTAAGAAGGAGGCAGG + Intronic
936469531 2:112786554-112786576 GGTGAGGTTCAGAGAGAGGTGGG + Intergenic
936964131 2:118110435-118110457 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
937123796 2:119460061-119460083 GCCAAGGTTCAGAAGCAGGAGGG + Intronic
937377451 2:121347360-121347382 TCTGGGGTGCAGAAGCAGGAGGG + Intronic
937942890 2:127301789-127301811 GTTGAGCTTCAGAAAGATGAGGG - Exonic
938341167 2:130537558-130537580 GGGGGGGTTCAGGAGGAGGATGG + Intergenic
938814033 2:134881517-134881539 GTAGAGGTACAGAAGGGGGATGG - Intronic
938960062 2:136332896-136332918 GCTGGGGTCCAGGAGGAAGAGGG + Intergenic
939496905 2:142935793-142935815 GCTGAGGGTATGAAGGGGGAAGG + Intronic
940042980 2:149379667-149379689 TCTGTGGTTCTGAAGGAGCATGG - Intronic
941092207 2:161190783-161190805 CCAGAGGTTGAGAGGGAGGAAGG + Intronic
941133555 2:161684918-161684940 TCTGAGGTTCAAAAAGAGGCTGG + Intronic
941885831 2:170526178-170526200 ACTGAGGTTCAGAGAGAGGAAGG - Intronic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
944333378 2:198499735-198499757 ACTGATGTTCAGGAGCAGGAAGG + Intronic
944459331 2:199929658-199929680 GCTGCTGTTCAAAAGGATGAAGG + Intronic
944863225 2:203835199-203835221 ACTGAGGTCCAGGATGAGGATGG - Intergenic
946237390 2:218332541-218332563 GCTGAGATGGGGAAGGAGGAAGG - Intronic
947382495 2:229558859-229558881 GCTGAGGCAGAGAAGCAGGAGGG + Intronic
947605886 2:231484851-231484873 GCTGAGGAAGAGGAGGAGGAGGG - Intergenic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948308565 2:236968440-236968462 TGAGAGGGTCAGAAGGAGGAAGG + Intergenic
1168880202 20:1199967-1199989 ACTGGGATTCAGTAGGAGGAAGG - Intergenic
1169544359 20:6635444-6635466 AGTGAGGTTCAGAAGCATGAAGG - Intergenic
1170922082 20:20688629-20688651 ACTGAGGTATAGAAGTAGGAGGG - Intronic
1172029233 20:31969662-31969684 ACTGAGGCTTGGAAGGAGGAGGG - Intronic
1172726615 20:37048463-37048485 GTTGTGGATCAGAAGAAGGAAGG - Intronic
1172867923 20:38113875-38113897 GCTGAGGTCCAGCATGGGGAAGG + Intronic
1172867973 20:38114191-38114213 GCTTAGGTTCAGCTGTAGGAAGG + Intronic
1174278220 20:49419264-49419286 GCTGAGGTTCCGAGTGGGGAAGG + Intronic
1174733841 20:52945083-52945105 GCTGAGGAGGAGAAGGAAGAGGG + Intergenic
1174896056 20:54451397-54451419 GCTGAGTTTGAGAGGGCGGAGGG + Intergenic
1175135578 20:56821171-56821193 GCTAAGGTCCAGAAGAGGGAGGG + Intergenic
1175883555 20:62274533-62274555 GCTGTGGTTCTGAAGGAGGGAGG + Intronic
1176020829 20:62961596-62961618 GCTGAGGTTCAGAGGGGCGGAGG + Intronic
1177501584 21:21963839-21963861 GATGAAGTTTAGAAAGAGGAAGG + Intergenic
1177728268 21:24995288-24995310 GCTGGGGCACAGAAGGAGGGGGG + Intergenic
1177916560 21:27095608-27095630 GCTAAATTTCAGAAGGAGGTGGG + Intergenic
1178603453 21:34014924-34014946 CCAGTGGTTCAGAAGGAGGGAGG + Intergenic
1179286703 21:39983816-39983838 GATGTGGTGCAGAAGGGGGAAGG - Intergenic
1179667723 21:42924109-42924131 GCTGAGGGTTTGAAGGGGGAAGG + Intergenic
1180075424 21:45459279-45459301 GGTGAGGGGCAGGAGGAGGAGGG + Intronic
1180948459 22:19709539-19709561 GCTGAGGGTCTGAGGGAGGTGGG - Intergenic
1180981087 22:19878319-19878341 GCTGAGGATGAGAGGGAGGGTGG - Intronic
1181688387 22:24544392-24544414 GCTGGGGTGCAGTAGGAGGATGG - Intronic
1181975593 22:26727103-26727125 ACAGAGGTTCAGAAGGTTGATGG + Intergenic
1181985548 22:26797888-26797910 ACTGAGCTTCAGATGGAGCAGGG + Intergenic
1182552212 22:31106578-31106600 GCTGAGGGTAGGATGGAGGAGGG - Intronic
1183037221 22:35149434-35149456 GCAGATGTTCAAAAAGAGGATGG + Intergenic
1183645452 22:39123766-39123788 GCAGAGGAGCACAAGGAGGAAGG + Intronic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1184124153 22:42475238-42475260 GGTGAGGCTCAGAGGGAGGCTGG - Intergenic
1184487935 22:44792402-44792424 GGTGAGGCCCAGGAGGAGGAAGG - Intronic
1184555919 22:45233076-45233098 ACTGAGGCTCAGAAGCAGGAGGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1185210691 22:49569056-49569078 GCTGAGGTGCAGGAGGAGCCGGG - Intronic
950885922 3:16362820-16362842 GCCGAGGTCCAGAAGAGGGAAGG + Intronic
951619953 3:24590145-24590167 GCTCAGCTTCAGGAGGAGGGGGG + Intergenic
952210186 3:31222472-31222494 ACTGTGGTGCAGAAGGAGGGAGG - Intergenic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
952377841 3:32781732-32781754 GCTGAGGGTCAGCTGGAGGGCGG - Intergenic
954597870 3:51842252-51842274 GCTGCAGTTCAGAAAGAAGAAGG - Intergenic
954942309 3:54385334-54385356 GCTGAGGCTCAGACAGGGGAAGG + Intronic
955428086 3:58813329-58813351 GCTGATGTTCAAAAAGAGGATGG - Intronic
956008535 3:64805951-64805973 GGTCAGTTACAGAAGGAGGAAGG - Intergenic
956047755 3:65214546-65214568 GATGAGGCACAGAAGGAGAAAGG + Intergenic
956494994 3:69815402-69815424 GCTGAGGGGGAGAAGGAAGAGGG - Intronic
957169018 3:76712957-76712979 TCTGAGTTTCACAAGGAGTAAGG + Intronic
959663264 3:108892877-108892899 ACTGTGTTTCAGAAGGAAGAAGG - Intergenic
960789881 3:121417158-121417180 GCTGAGGCACAGAAGGAACAGGG + Intronic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961695052 3:128698608-128698630 GCTGAGGTCCTGGGGGAGGAGGG - Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961911160 3:130317952-130317974 TCTGAGGCTCAGAATGGGGATGG - Intergenic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
963291576 3:143495576-143495598 GCTTAGCCTCTGAAGGAGGATGG + Intronic
964519984 3:157554614-157554636 GAAGAGGTTCAGGAGGAGTAAGG + Intronic
965749309 3:171959747-171959769 GCTGAGAGTCAGCAGGAGGGAGG + Intergenic
966932429 3:184684598-184684620 GCAGCCATTCAGAAGGAGGACGG + Intronic
967363082 3:188654247-188654269 GAGGAGGTTCAGAAGGAAAATGG + Intronic
967893770 3:194381761-194381783 GCAGAGATTCAGAAGGAGGGCGG + Intergenic
967954288 3:194865801-194865823 ACTGAGACTCAGAAGTAGGAAGG + Intergenic
968232912 3:197014997-197015019 GCTGAGATTCAGAAAGGGGAAGG + Intronic
968748276 4:2372387-2372409 GCTGAGGACTAGAAGGAGGATGG - Intronic
969304872 4:6319869-6319891 CTTCAGGTTCAGCAGGAGGAAGG - Intergenic
969694050 4:8725003-8725025 GGTGAGCTTCAGCATGAGGAGGG - Intergenic
969867909 4:10087276-10087298 GCTGAGGTCCAGGGGCAGGAGGG - Intronic
970410291 4:15799868-15799890 GCTCAGGCACAGAGGGAGGAGGG + Intronic
972220249 4:36947226-36947248 GATGAGGTTCAGAAAGTTGAGGG - Intergenic
972323303 4:37992320-37992342 GCTGAGGGAAAGAAGGAGTAAGG + Intronic
972362687 4:38342998-38343020 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
973191682 4:47392646-47392668 GCTGAAGATTAGAAGGTGGAAGG - Intronic
973726090 4:53777450-53777472 GTTTTGGCTCAGAAGGAGGAAGG + Intronic
973730180 4:53815617-53815639 GGTGAGGTATAGGAGGAGGAAGG - Intronic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
974925280 4:68291182-68291204 GCTGAGGATGATGAGGAGGAAGG - Intergenic
974950210 4:68577667-68577689 GCTGAGGGTTTGAAGGGGGAAGG - Intronic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
976300206 4:83509353-83509375 GCTGAGGGTTTGAAGGGGGAAGG + Intronic
976486913 4:85617331-85617353 GCTGAGTAACAGAAGTAGGAAGG - Intronic
976621708 4:87134936-87134958 GCAGAGCTTCAGAAGGGGCAAGG - Intronic
977522240 4:98099478-98099500 GATGAGGCTCACAAGGAGGTGGG + Intronic
977997635 4:103514606-103514628 GCTGAGGTTCAGAAGGGCAGAGG + Intergenic
978310738 4:107382535-107382557 GCTAAGACTGAGAAGGAGGAAGG + Intergenic
979206604 4:118046103-118046125 GCTGAGGCTGAGAAGGGAGAAGG + Intronic
979670662 4:123357244-123357266 GCTGAGGGCCACAAAGAGGAGGG - Intergenic
980833046 4:138155012-138155034 GCACAGGTTCAGCAAGAGGAAGG - Intergenic
981564893 4:146089900-146089922 GCTGATTTAGAGAAGGAGGAAGG + Intergenic
981736838 4:147962236-147962258 GCAGTGGGTCAGAAGGAAGAAGG - Intronic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
984836566 4:184027955-184027977 TGTGAGGTTCAGAGGGAGGAGGG + Intergenic
985223390 4:187732042-187732064 GCTGAGGGGGAGGAGGAGGACGG - Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
989129763 5:38095343-38095365 GCTGAGGTTTAGGAGGTGGCAGG - Intergenic
990754751 5:59056293-59056315 GGTGAGGGTAAGAAGGAGGTAGG + Intronic
991528120 5:67585955-67585977 CCAGGTGTTCAGAAGGAGGAAGG + Intergenic
991597467 5:68320328-68320350 GCTGGGGTGGAGAAGGAGGGAGG + Intergenic
991649989 5:68842804-68842826 GGTGGCATTCAGAAGGAGGATGG - Intergenic
992140254 5:73789381-73789403 GCTGGGGTGTGGAAGGAGGATGG + Intronic
992410239 5:76498460-76498482 CCTGAGGTTTGGAATGAGGAGGG - Intronic
993272005 5:85808756-85808778 CCTGAATTTCAAAAGGAGGAGGG + Intergenic
993929730 5:93923074-93923096 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
995329013 5:110925868-110925890 GTTGAGGATCAGAAGTAGGATGG - Intergenic
995387763 5:111607144-111607166 GCTGGGGAAGAGAAGGAGGAGGG - Intergenic
995700703 5:114931816-114931838 GCTGTGGTTGAGCATGAGGAAGG - Intergenic
996416980 5:123221208-123221230 GCTGAGGATCAAGAGGTGGATGG - Intergenic
996532862 5:124544483-124544505 GCTGAGGGTGAGTAGGAGGTGGG - Intergenic
996638616 5:125725938-125725960 GCAGCGGCTGAGAAGGAGGACGG + Intergenic
997225197 5:132204602-132204624 ACTGAGGTTCGGAAGGATGGTGG - Intronic
998819398 5:146044653-146044675 GCAGAGGGACAGAGGGAGGAAGG - Intronic
999061204 5:148637894-148637916 GATGATGTTCAGAAGGAAAAGGG - Intronic
999408237 5:151326076-151326098 GATGAGGGTAAGGAGGAGGAAGG + Intronic
999710525 5:154314428-154314450 ACTGAGGTCTAGAATGAGGAGGG - Intronic
1001728886 5:173933053-173933075 GCTAAGTTTCACCAGGAGGAGGG + Intronic
1001948261 5:175797622-175797644 GCTGAGTTTCCGTAGGGGGAGGG + Intronic
1002848524 6:970055-970077 GGTGAGGTTCACAATGACGATGG - Intergenic
1002965673 6:1963920-1963942 ACTGAGGTTCAGAAAGATGGAGG + Intronic
1003315454 6:5007712-5007734 GTTCAGGTTCAGCAGGAGGGCGG - Intergenic
1003497734 6:6678909-6678931 GCTGAGGTTTAGAAGGAAGGTGG + Intergenic
1003676545 6:8209913-8209935 ACTGAGGTTCAGAGAGATGATGG - Intergenic
1004002805 6:11610891-11610913 GGTGAGGTGAGGAAGGAGGAGGG + Intergenic
1004205656 6:13589602-13589624 TCAGATGTTCAGAAGAAGGAAGG - Intronic
1005419543 6:25634726-25634748 GCTGAGGTTCAGAATGTGCTTGG - Intergenic
1005470543 6:26158227-26158249 ACTAAGGCTCAGAAGAAGGACGG + Exonic
1005504615 6:26458677-26458699 GCTGAGGAGGAGGAGGAGGAGGG - Exonic
1005704980 6:28442586-28442608 ACTGAGGTACAAAAGAAGGACGG + Intronic
1006338261 6:33432044-33432066 GCTGAGGGGCAGAGGGAGGTGGG + Intronic
1006361027 6:33587158-33587180 ACTGAGGCTCAGAAAGAGGAAGG - Intergenic
1006370173 6:33639426-33639448 GAGGAGGTACAGAAGGAGCACGG + Intronic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1006826422 6:36939294-36939316 GCAGAGGACCAGAAGGAGGTTGG + Intergenic
1008350713 6:50486870-50486892 CCAGAGGTTTAGAATGAGGAAGG + Intergenic
1008496946 6:52143730-52143752 CCTGAGCCTCAGAAGGATGAGGG - Intergenic
1008533372 6:52485920-52485942 GGTGAGGATCAAAATGAGGATGG - Intronic
1008585992 6:52949964-52949986 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009487781 6:64247334-64247356 TCTGAGCCTCACAAGGAGGAAGG + Intronic
1010429223 6:75759460-75759482 GCTGCGGTTTTGAAGCAGGAGGG + Intronic
1011057607 6:83222665-83222687 GCTGAGGCTTGGGAGGAGGAGGG + Intronic
1011824246 6:91287732-91287754 GCTGTGTTTCAGAATGAGCAAGG + Intergenic
1011945647 6:92898822-92898844 GCTGAATTTCAAGAGGAGGATGG - Intergenic
1012980068 6:105819916-105819938 GCTGAAGCTCAGAATGAGGATGG + Intergenic
1015452036 6:133381010-133381032 GAGGAGGTAGAGAAGGAGGAGGG - Intronic
1015712678 6:136159381-136159403 GCTGGGGTTCAGATTGGGGATGG - Intronic
1017770268 6:157639047-157639069 GCTGAGCATCAAAAGGAGGCAGG + Intronic
1018021770 6:159767794-159767816 GCTGAGGTTCAGGAGGAGGCAGG + Intronic
1018376683 6:163219627-163219649 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018376691 6:163219662-163219684 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018844711 6:167547517-167547539 GATGGGGTGAAGAAGGAGGAGGG - Intergenic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1018864232 6:167734965-167734987 GAGGAGGGTCAAAAGGAGGATGG + Intergenic
1019138703 6:169929439-169929461 GGTGAGGTTAAAAGGGAGGATGG + Intergenic
1019494763 7:1332553-1332575 GCTGTGGCTCTGGAGGAGGAAGG - Intergenic
1020384007 7:7577764-7577786 GCTGCTGTTGAGAAGGAGCAGGG + Intronic
1021239181 7:18179380-18179402 GCTGAGGTCCTAAGGGAGGAGGG + Intronic
1022480585 7:30740798-30740820 ACTGAGCTTCAGCAGCAGGATGG + Intronic
1023223257 7:37943063-37943085 GCTGAGGCTCAGCAGCAGCAGGG + Intronic
1023714459 7:43029170-43029192 GCTGAGGTGGAGAATGAGGTGGG + Intergenic
1023806101 7:43874160-43874182 GCTGAGGTTCAAAACCAGGCCGG + Intronic
1024353974 7:48395606-48395628 GCTGAGGAGGAGGAGGAGGAAGG - Intronic
1024639576 7:51317775-51317797 GCAGGGGATCAGAGGGAGGAAGG - Intergenic
1024907097 7:54398025-54398047 GCTTATGTTGAGATGGAGGAAGG - Intergenic
1025142592 7:56478518-56478540 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025610806 7:63074056-63074078 GATGAGCTGCAGAAGGAGCAGGG - Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1025708653 7:63889119-63889141 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1026995080 7:74610471-74610493 TCTGAGGTTCAGAAAGATGAAGG + Intergenic
1027218636 7:76200372-76200394 GCTGAGGAAGGGAAGGAGGATGG + Intergenic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1029803602 7:102975042-102975064 GCTGAGGGTTTGAAGGGGGAAGG - Intronic
1030093995 7:105881605-105881627 CCTGAGGTTCAGAAGGATCAAGG - Intronic
1030617869 7:111757115-111757137 GCGGAGGCTGAGAGGGAGGAGGG + Intronic
1031214361 7:118871084-118871106 GCTGCTGTTTAGAAGGAAGAGGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032548997 7:132766886-132766908 GGTGAGCTGCAGCAGGAGGAGGG + Intergenic
1032683525 7:134209218-134209240 GTAGAGGTTCAGACAGAGGAGGG - Intronic
1033041689 7:137925093-137925115 CCTGGGGTTCAGGTGGAGGATGG + Intronic
1033425861 7:141243622-141243644 GCTGGATTTGAGAAGGAGGAAGG - Intronic
1033647037 7:143313091-143313113 GTAGAGGCTCAGAAGGAGGGAGG + Intergenic
1033793382 7:144818730-144818752 GCTGAGGCTCAGTAGCAAGAGGG + Intronic
1034400708 7:150859812-150859834 GCTGAGGAAGAGGAGGAGGAGGG + Intronic
1034420859 7:150989905-150989927 GCTGAGGGTCACAGGGAGGATGG - Intergenic
1034997895 7:155589919-155589941 GCTGAGGTCCAGAGGAGGGAGGG - Intergenic
1035748581 8:1979212-1979234 GCGGAGGTTCCCGAGGAGGAGGG - Intronic
1036162933 8:6406308-6406330 GCTGAGGATCAGGAAGGGGAGGG - Intergenic
1036434296 8:8718996-8719018 GTTGAGGTTCAGAGGAAGGAGGG - Intergenic
1036448727 8:8846288-8846310 GAGGAGGATAAGAAGGAGGAGGG + Intronic
1037900101 8:22683168-22683190 GTTGAGATTCAGATGTAGGAGGG + Intergenic
1038049122 8:23792546-23792568 GCTGGGTTTAAGATGGAGGAAGG - Intergenic
1038104459 8:24416752-24416774 GCTGAGGTTAAGGAGAAGGGAGG - Intergenic
1041198455 8:55425481-55425503 CCTGAGGCTCAGAAGGATCAAGG - Intronic
1041371466 8:57165142-57165164 GCTGTGGATCAGAGGCAGGAGGG - Intergenic
1041758851 8:61342173-61342195 GGTGAGGCTGAGCAGGAGGAGGG - Intronic
1042368072 8:67959376-67959398 GCTGAGGATGTGAAGGATGATGG + Intronic
1043623512 8:82227440-82227462 GCTCAGGCTCAGGTGGAGGATGG - Intergenic
1044424638 8:92037234-92037256 GCTGATGTTGAGAAGGAGGGAGG + Intronic
1044728488 8:95212133-95212155 GCTGTGGTTTAGGGGGAGGAGGG + Intergenic
1044931852 8:97259216-97259238 ACTGGGGTTCAGAGGCAGGAGGG + Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1046097792 8:109580840-109580862 GCTGTAGTACAGAGGGAGGAGGG - Intronic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1047210331 8:122835353-122835375 GCTGAGGGTTTGAAGGGGGAAGG + Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047508550 8:125498513-125498535 GCAGAGATTCATAAGAAGGAGGG - Intergenic
1047929567 8:129713342-129713364 GCTGAGGCTCTCAAGGAGCAAGG + Intergenic
1048053355 8:130840231-130840253 GCTGGGGTTCAGAAGGCAGATGG + Intronic
1048426581 8:134329125-134329147 GCTGAGGGTCAGAGGAAGAAAGG - Intergenic
1048878496 8:138855059-138855081 GCTGAGACTCAGAAGGATGCTGG - Intronic
1049167238 8:141133951-141133973 GCTGAGGTCCTTCAGGAGGATGG + Intronic
1049204088 8:141355319-141355341 ACTGAGGCTCAGAGGGAGAAAGG - Intergenic
1049264673 8:141661084-141661106 GCTGAGATACCAAAGGAGGAGGG + Intergenic
1049974344 9:847157-847179 GCTGGGGTTCACATGGAGGCTGG + Intronic
1050482046 9:6097483-6097505 TCTGAGGCTCAGAATGGGGAAGG - Intergenic
1052156011 9:25191610-25191632 GCTGAGGATGATGAGGAGGAAGG - Intergenic
1052712951 9:32079096-32079118 GGGGAGGTTGAGAAGGAGAAGGG - Intergenic
1052741165 9:32394383-32394405 TCTGAGCATCTGAAGGAGGATGG + Intronic
1052999678 9:34571080-34571102 GCTGAGGGTCAGAAGGAGCCAGG - Intronic
1053294840 9:36905396-36905418 ACTGAGGTTCAGAGAGGGGAAGG + Intronic
1055766066 9:79664741-79664763 GCTGAAGTCTAGAAGGAGGATGG - Intronic
1055770806 9:79715364-79715386 GCTGAGGTTCTGAGGGATGATGG - Intronic
1056746065 9:89304138-89304160 GCTCAGGCACAGAAGGAGGTTGG + Intergenic
1056932984 9:90893939-90893961 GCTGTGCTTCAGCAGCAGGAGGG - Intronic
1057380173 9:94560246-94560268 GCTGCTGTTCAGAGGAAGGAAGG + Intronic
1057524470 9:95786492-95786514 GATGAGTTTCAGGAAGAGGAGGG + Intergenic
1058145882 9:101410889-101410911 ACTGAGGTACAGGAGAAGGAGGG - Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058465394 9:105221946-105221968 GCTGGGGTTCAGAGAAAGGAGGG + Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1060186729 9:121568236-121568258 GCTGAGCTCCTGCAGGAGGAAGG - Intronic
1060452395 9:123755493-123755515 GCTGAGGTGGAAGAGGAGGAAGG - Intronic
1060515509 9:124263313-124263335 CCTGAGGCTCAGAGGGAGCAAGG + Intronic
1060539853 9:124421960-124421982 GCTGAGACTCAGAAGGACCAGGG + Intergenic
1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG + Intronic
1060965285 9:127709018-127709040 ACTGAGGCTCAGAAGGATAAAGG - Intronic
1060979242 9:127783240-127783262 GCTGGGGTTCAGACGAGGGATGG + Intergenic
1061477835 9:130880796-130880818 GTTCAGCTTCGGAAGGAGGAAGG + Intronic
1061489861 9:130938914-130938936 GCGGAGATTGAGAAGGAGGGAGG - Intronic
1061759657 9:132841660-132841682 ACTGAGGCCCAGATGGAGGAAGG - Intronic
1062159299 9:135070879-135070901 GCTGAGGTTCAGGTAGAGGGAGG - Intergenic
1062624256 9:137435785-137435807 GGTGAGGTTCAGGAAGTGGAAGG + Exonic
1186107905 X:6226667-6226689 GTTGAGGGACAGGAGGAGGAAGG + Intronic
1186792424 X:13011940-13011962 TCTGAGGCTCAGAAAGATGAAGG - Intergenic
1188897108 X:35682742-35682764 GCTCAGGGTCAGATGGAGGCTGG - Intergenic
1191054986 X:56232316-56232338 GGTGGGGCTGAGAAGGAGGAGGG - Intergenic
1191663549 X:63674792-63674814 GCTCAGGCACAGAAGGAGGTAGG - Intronic
1191666658 X:63709403-63709425 TCCGTGGTTTAGAAGGAGGAGGG - Intronic
1191883301 X:65863652-65863674 ATTGAGGTTTAGAAAGAGGATGG - Intergenic
1192005602 X:67208750-67208772 AATGAGGTCCAGAAAGAGGAAGG - Intergenic
1192362479 X:70448469-70448491 ACTGTGGTTCAGAAGGGGAAGGG + Intronic
1192559123 X:72113886-72113908 ACTGAGGGTCAGAAAGAGGAAGG - Intergenic
1193689481 X:84622861-84622883 GCTGAGGCTGAAAAGGAGGCTGG - Intergenic
1193693775 X:84681058-84681080 GCTCAGGCTCTGAAGGCGGAAGG + Intergenic
1193713261 X:84904014-84904036 GCAGAGGTTCTGTAGGTGGATGG - Intergenic
1194122340 X:89976415-89976437 GGAGAGGTTCAGAAGAAGGTAGG - Intergenic
1195431238 X:104791770-104791792 ACTGAGGTTCAGTAAGAGGAAGG - Intronic
1195431276 X:104792137-104792159 ACTGAGGTTCAGAAAGAGGAAGG + Intronic
1195705564 X:107735698-107735720 GCTGAGGGGAAGAAGGAGAAGGG - Intronic
1197875712 X:131103383-131103405 GCTGAGGATAAGAAGGAATAGGG - Intergenic
1198651763 X:138870900-138870922 GCTGAGGATCAAAAGGAGCAAGG + Intronic
1198722829 X:139642467-139642489 GATGAGGTTCAGAAGGAATGCGG - Intronic
1199540494 X:148953055-148953077 ACTGAGGTTCAGAAAGGGGGTGG - Intronic
1199881464 X:151976739-151976761 GATGAGGTTTATAAGGAAGATGG - Intergenic
1199982821 X:152930166-152930188 GCTATGGTGCAGAAGGTGGAAGG - Intronic
1200475200 Y:3633850-3633872 GGAGAGGTTCAGAAGAAGGTAGG - Intergenic
1200834289 Y:7717921-7717943 ACTGAGGTCCAGAAGAGGGAAGG + Intergenic
1201857715 Y:18563909-18563931 GCAGAGGTGCAGAGGAAGGAGGG + Intronic
1201875606 Y:18756472-18756494 GCAGAGGTGCAGAGGAAGGAGGG - Intronic