ID: 908361154

View in Genome Browser
Species Human (GRCh38)
Location 1:63369290-63369312
Sequence GGGATAACTCCAGAACTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908361154_908361158 13 Left 908361154 1:63369290-63369312 CCAATCAGTTCTGGAGTTATCCC 0: 1
1: 0
2: 1
3: 10
4: 90
Right 908361158 1:63369326-63369348 TTTAAATAAGAAAATAATTAGGG 0: 1
1: 2
2: 14
3: 240
4: 2086
908361154_908361159 17 Left 908361154 1:63369290-63369312 CCAATCAGTTCTGGAGTTATCCC 0: 1
1: 0
2: 1
3: 10
4: 90
Right 908361159 1:63369330-63369352 AATAAGAAAATAATTAGGGCCGG 0: 1
1: 0
2: 9
3: 183
4: 1711
908361154_908361161 26 Left 908361154 1:63369290-63369312 CCAATCAGTTCTGGAGTTATCCC 0: 1
1: 0
2: 1
3: 10
4: 90
Right 908361161 1:63369339-63369361 ATAATTAGGGCCGGGTGCAGTGG 0: 1
1: 13
2: 242
3: 1635
4: 7698
908361154_908361160 18 Left 908361154 1:63369290-63369312 CCAATCAGTTCTGGAGTTATCCC 0: 1
1: 0
2: 1
3: 10
4: 90
Right 908361160 1:63369331-63369353 ATAAGAAAATAATTAGGGCCGGG No data
908361154_908361157 12 Left 908361154 1:63369290-63369312 CCAATCAGTTCTGGAGTTATCCC 0: 1
1: 0
2: 1
3: 10
4: 90
Right 908361157 1:63369325-63369347 TTTTAAATAAGAAAATAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908361154 Original CRISPR GGGATAACTCCAGAACTGAT TGG (reversed) Intronic