ID: 908365519

View in Genome Browser
Species Human (GRCh38)
Location 1:63419355-63419377
Sequence CAGCTAACCTTTAAGAAAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908365519 Original CRISPR CAGCTAACCTTTAAGAAAAA AGG (reversed) Exonic
901363786 1:8727798-8727820 CTGCTGACCTTTAAGAATAGTGG - Intronic
901499764 1:9644745-9644767 CAGCAATCCTAGAAGAAAAATGG + Intergenic
903082615 1:20822906-20822928 GAACTAACCTTTAAGAATTAGGG - Intronic
904156373 1:28486694-28486716 CAGCTAACTTTTAATAGAGATGG - Intronic
906570908 1:46838724-46838746 CAGCAAAACTTTCAGAAACAAGG - Intergenic
906600367 1:47122732-47122754 CAGCAAAACTTTCAGAAATAAGG + Intergenic
908362264 1:63381014-63381036 ATGCTAAACATTAAGAAAAATGG + Intronic
908365519 1:63419355-63419377 CAGCTAACCTTTAAGAAAAAAGG - Exonic
910669330 1:89757389-89757411 CAGCTAATATTTAAAACAAATGG + Intronic
911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG + Intronic
911541815 1:99165528-99165550 CAACAAACCTTTAAGGTAAAGGG + Intergenic
911634165 1:100214809-100214831 AATCTCACCTTTAAGAAGAAAGG + Exonic
911991488 1:104703600-104703622 CAGACAAACTTTAAAAAAAAGGG + Intergenic
915683642 1:157607761-157607783 CAGTTATCCTTTAGGAATAAAGG + Intergenic
916098578 1:161373627-161373649 CAGGTTACCTTAAACAAAAAAGG + Exonic
916299330 1:163256408-163256430 CCACTGAACTTTAAGAAAAATGG - Intronic
916710435 1:167401030-167401052 AAGCAAACTTTTAAAAAAAACGG - Intronic
918456140 1:184717502-184717524 AGGCTAAACTTTAAGTAAAATGG + Intronic
918497138 1:185153520-185153542 CTGGTGACCTTTAAGAAAACAGG + Intronic
920187221 1:204167279-204167301 CAGTTCAACTTTAAAAAAAATGG + Intergenic
921829269 1:219709108-219709130 AAGCTTACCTCTAGGAAAAAAGG - Intronic
922377389 1:224982053-224982075 TAACTAACCTTTGAGACAAATGG + Intronic
923496142 1:234526500-234526522 CAAGTAACCTTTAAGGATAATGG - Intergenic
924011018 1:239665397-239665419 CTGATAACCTTTAAGACCAATGG - Intronic
924016318 1:239728065-239728087 TAGCAAACCTTTAACAACAATGG - Intronic
924162090 1:241243629-241243651 CAGCTGCCCTTTAACAAAATAGG + Intronic
1063182783 10:3620969-3620991 CAGACAAATTTTAAGAAAAATGG - Intergenic
1063793189 10:9478620-9478642 CAGCTAACCTTAAAGTACCAAGG + Intergenic
1064423214 10:15207978-15208000 CAGCTACTTTTTAAGGAAAATGG - Intergenic
1067383907 10:45801040-45801062 CAGCTAACATTTTTGCAAAATGG + Intergenic
1067896531 10:50186827-50186849 CATCTTACATATAAGAAAAATGG - Exonic
1067952441 10:50755200-50755222 CATCTTACATATAAGAAAAATGG + Intronic
1068749526 10:60575812-60575834 CAACTTACCTTTAATAGAAAAGG + Intronic
1068763569 10:60738142-60738164 CAGCTTCCCTTTAATAAAATGGG - Intergenic
1070945825 10:80390819-80390841 CAGCTTTCTTTTAAGAAAAACGG - Intergenic
1071753143 10:88504100-88504122 CAGCTAAACCTTATGAAAACTGG + Intronic
1071932753 10:90491639-90491661 AAGAAAACCTTTAAGAAATATGG + Intergenic
1072255164 10:93614125-93614147 CAGTTTACCATTAACAAAAAGGG + Intronic
1072481421 10:95812951-95812973 CAGCTCACCTAATAGAAAAATGG - Intronic
1072606407 10:96986897-96986919 CAGCAAACCTTTAACAGAATGGG - Intergenic
1073388083 10:103144388-103144410 CAGCTAACATTACAGGAAAAAGG + Intronic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1076340538 10:129742244-129742266 CCAATAACTTTTAAGAAAAAAGG - Intronic
1080115715 11:28619409-28619431 CAGCAAACGTTACAGAAAAAAGG + Intergenic
1080388110 11:31822015-31822037 CTGCAACCCTTTAATAAAAAAGG + Intronic
1080410761 11:32022853-32022875 CAGGTAACATTCAAGAAAAAAGG + Intronic
1081029640 11:38062665-38062687 AAGCTAACGTTTAAAAGAAATGG + Intergenic
1087430687 11:98050153-98050175 AAGCTAACTTTTAGGAAAGATGG - Intergenic
1089172343 11:116521837-116521859 AAGGGAAACTTTAAGAAAAATGG + Intergenic
1089810358 11:121126382-121126404 CTCCTAATATTTAAGAAAAAGGG - Intronic
1089940866 11:122416016-122416038 CAACTAGCTTTTAGGAAAAAAGG - Intergenic
1090949051 11:131456589-131456611 CAGCTCAGCTCTAAGAGAAATGG + Intronic
1091661758 12:2389475-2389497 TGGCTAAACTTTAAGTAAAAGGG + Intronic
1092092759 12:5817257-5817279 CAGCTTACTTTTATGTAAAATGG - Intronic
1093274953 12:17114162-17114184 TAGATAACATGTAAGAAAAATGG + Intergenic
1093863277 12:24194334-24194356 CAGCTAACATATAATAAATATGG + Intergenic
1095771446 12:45963873-45963895 GAGTAAACCTTTAAGAAAAAAGG + Intronic
1098348701 12:69533670-69533692 CACATAACCTTTAAGTAAACAGG - Intronic
1098828169 12:75326074-75326096 CAGATAACATTTCAGAAATAGGG - Intronic
1099999382 12:89814650-89814672 CAGCTAACCCTTAAACAACATGG + Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1103114263 12:118311775-118311797 CCAATAAACTTTAAGAAAAAAGG + Intronic
1105364790 13:19754922-19754944 CAGGAACCCTTTAAAAAAAATGG + Intronic
1106438399 13:29743749-29743771 CAGTCAACCTTGCAGAAAAAAGG + Intergenic
1106969947 13:35127254-35127276 AAACTATCCTTTAAGTAAAAAGG + Intronic
1107236312 13:38175187-38175209 CAGCAAACTTTTTATAAAAAGGG + Intergenic
1111797300 13:92938832-92938854 TAGCTTACCTTTAAAAAAATTGG + Intergenic
1113511429 13:110857868-110857890 GAGTTATCTTTTAAGAAAAATGG - Intergenic
1113539660 13:111096323-111096345 CAGAAGACCTTTAAGAAACAGGG - Intergenic
1115226339 14:31106157-31106179 CAGCAAACATTAAAAAAAAAAGG + Intronic
1115339713 14:32280139-32280161 AAAATAACCATTAAGAAAAAAGG - Intergenic
1116822630 14:49640337-49640359 AAGCTATCCTTAAAAAAAAATGG + Intergenic
1117001010 14:51371185-51371207 CACCTAATCTTTAAGCAAAGGGG - Intergenic
1117311365 14:54526732-54526754 GAGCTAACATTAAAGCAAAAGGG + Intronic
1120715596 14:87837768-87837790 CAGATAACTTTTAAAGAAAAGGG + Intergenic
1122502662 14:102211629-102211651 CAGTTCACCTTTAGGAACAAAGG - Intronic
1126652184 15:50935708-50935730 CTGCGGACCTTTAAGAACAATGG + Intronic
1127214331 15:56808758-56808780 CAGATCACCTTTATCAAAAAAGG - Intronic
1130103038 15:80908399-80908421 CAGCTAACCTCTACTAAAGAAGG - Intronic
1130372021 15:83293101-83293123 CTACTATCCTTAAAGAAAAATGG - Intergenic
1136751843 16:32644270-32644292 CAGCTGACCCTTAAGCAACACGG + Intergenic
1142307817 16:89295371-89295393 CACCTCATCTTTAAGAAACAAGG + Intronic
1203053979 16_KI270728v1_random:903525-903547 CAGCTGACCCTTAAGCAACACGG + Intergenic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1143817342 17:9527736-9527758 CAGCTAAGGTTTAAGGAAAGGGG + Intronic
1144119262 17:12134495-12134517 TAGTTAATCTTTAAGAATAAAGG + Intronic
1144657524 17:17046647-17046669 AAACTAACCTTACAGAAAAATGG - Intronic
1152119250 17:78407937-78407959 CAGAAAACCCTTAAGAATAAAGG - Intronic
1153022393 18:641814-641836 GAGGTAACCTTGAAGAAATATGG + Intronic
1153122405 18:1745115-1745137 AAACTATCCTTTAAGAATAAAGG - Intergenic
1153360026 18:4184092-4184114 TGGATAAACTTTAAGAAAAAAGG + Intronic
1153591000 18:6674160-6674182 CAGCTAAGTTTTCAGAAAGACGG - Intergenic
1153671988 18:7420270-7420292 CAGCAAACCTTCAAGGAAAGTGG - Intergenic
1155825481 18:30437149-30437171 TAGCTAACCTATAGGAAATAAGG - Intergenic
1155841679 18:30652643-30652665 CAGCTATGCTTCAAGATAAAGGG + Intergenic
1156036751 18:32772726-32772748 CAGCAAACCTTTAAAAAGGAAGG - Exonic
1157110779 18:44818297-44818319 CACCGAACCTTAAAGAAAGAAGG + Intronic
1158378355 18:56899812-56899834 CATATAAGCTTTAAGAATAAAGG + Intronic
1160556037 18:79725894-79725916 CAGCTTACCTACAGGAAAAACGG - Intronic
1163365524 19:16873863-16873885 ATGCTAATTTTTAAGAAAAAGGG - Intronic
1167310022 19:48731767-48731789 CATCTACCCTTGTAGAAAAATGG + Intronic
1167507141 19:49876789-49876811 CAGCTTGCCCCTAAGAAAAATGG + Exonic
1167682162 19:50930480-50930502 CATCTATCCTGTAGGAAAAAGGG - Intergenic
926317100 2:11718200-11718222 CAGGTAACCTCTCAGGAAAAGGG + Intronic
927309081 2:21608003-21608025 CAGCTAAAATTTAAGGCAAAGGG + Intergenic
927375214 2:22405424-22405446 CTGCTGACCATTAAGGAAAAGGG + Intergenic
928040763 2:27874632-27874654 AAATTAACCTTTAAGAGAAAGGG - Intronic
929369031 2:41198880-41198902 CAGCTAAACTATAAACAAAATGG - Intergenic
930155345 2:48101640-48101662 CACCTAATGTTTAAGGAAAAAGG + Intergenic
930923398 2:56785878-56785900 AAGCTAACCAATAAGAAAAATGG - Intergenic
930963232 2:57286880-57286902 GAGCTTTCCTTTAAGAAAGAAGG - Intergenic
931761665 2:65422943-65422965 GACTTAACCTTTAAGCAAAAGGG + Intronic
932100363 2:68894130-68894152 CACCTAAACTTAAAGTAAAAGGG - Intergenic
932652965 2:73579627-73579649 CAGCAAAACTTTAAGAATAAAGG - Intronic
937618191 2:123951935-123951957 AATGTAAACTTTAAGAAAAATGG + Intergenic
939619589 2:144402154-144402176 CAGCTGACCTTTTTGAACAAGGG + Intronic
939749401 2:146023009-146023031 AAGCAAACCTTCTAGAAAAAGGG - Intergenic
940041474 2:149366182-149366204 AAGCTCACATTTAATAAAAAAGG - Intronic
940047523 2:149425062-149425084 CAGCTTATCTGGAAGAAAAAAGG - Intronic
940436359 2:153660654-153660676 CAGGTAACCTGAATGAAAAATGG - Intergenic
940523011 2:154775964-154775986 CAGATAACCTTTTTTAAAAAAGG + Intronic
941092742 2:161197080-161197102 CAGTTACCCTTGAGGAAAAATGG + Intronic
941128791 2:161620700-161620722 CACTTAACCATTAAGAAAAAGGG - Intronic
943348071 2:186764123-186764145 CAGGGAAATTTTAAGAAAAATGG - Exonic
943611598 2:190041226-190041248 CAGCTAACCAGAAAGAAGAAAGG - Intronic
945250941 2:207766444-207766466 CAGCTCACCTTAAAGAATCATGG + Exonic
945440534 2:209873708-209873730 CAAGTAATCTTTAAGAAAAGAGG - Intronic
946299053 2:218811386-218811408 CAGCTAGCCTTTTAAAAAAATGG + Intronic
946610323 2:221450841-221450863 AAGTTATCCTTTAAGAAATAGGG + Intronic
946619195 2:221542767-221542789 CAGCTACCCTTTAACATAAAGGG - Intronic
947649113 2:231769399-231769421 CTGCTAAAGATTAAGAAAAAGGG - Intronic
948156279 2:235785218-235785240 CTTCTCACTTTTAAGAAAAATGG - Intronic
948369851 2:237481862-237481884 CTGCTAAGCTTTGAGCAAAAGGG + Intergenic
948748988 2:240118252-240118274 CAGCTCACCTTTGAGGAAAGTGG + Intergenic
1169454348 20:5738946-5738968 CAGCATACTTTTCAGAAAAACGG - Intergenic
1169763827 20:9127607-9127629 CATTTAACTTTTAAAAAAAACGG + Intronic
1172050156 20:32110819-32110841 GAACTAAACTTTTAGAAAAAGGG - Intronic
1172747738 20:37226001-37226023 CAGCTAACTTTTTAGAAAGAAGG - Intronic
1174497861 20:50961567-50961589 CATTTAAGCTTTAAAAAAAATGG - Exonic
1177333875 21:19698758-19698780 CAGTTAATCTTTACAAAAAAGGG - Intergenic
1178715576 21:34961063-34961085 CAAATAAACTTTAAGAAACAAGG + Intronic
1180212567 21:46303494-46303516 CAGGCAACCTGAAAGAAAAATGG + Intronic
1180608237 22:17077735-17077757 GAGCTCACCTCTCAGAAAAATGG + Intergenic
1181692513 22:24572003-24572025 CAGATAACCTGAAAGAAAAAAGG - Exonic
1181840236 22:25651889-25651911 AAGTTAACCTTTACCAAAAAAGG + Intronic
1182929770 22:34161722-34161744 CAGCTAGCCTTACAGAGAAAGGG - Intergenic
1182959278 22:34456742-34456764 CATGTGACCTTTAAGTAAAAAGG - Intergenic
950571772 3:13804819-13804841 CAGCTGACCTTTGAGCAACACGG + Intergenic
951027092 3:17841777-17841799 AAGGCAACCTGTAAGAAAAAAGG + Intronic
951247876 3:20361955-20361977 CAGCCAACCTAAAAGAACAAAGG - Intergenic
951757844 3:26111758-26111780 CAGGTCACCTTTTAGAAGAAAGG + Intergenic
952551046 3:34477270-34477292 CCTGTAACCTTTATGAAAAAAGG - Intergenic
953006301 3:38982411-38982433 CATTAAACCATTAAGAAAAAAGG - Intergenic
953310514 3:41873253-41873275 AGGCTATCCTTTTAGAAAAATGG - Intronic
953457434 3:43054246-43054268 CAGCTACCCTCTAAGAGCAAAGG - Intronic
954000842 3:47555622-47555644 AAGATAACCTAAAAGAAAAATGG + Intergenic
955284883 3:57630736-57630758 CAGCTAACCTCTAGAATAAAAGG - Exonic
956043078 3:65167192-65167214 CAGCCAAACTTCAAGAAAAAAGG - Intergenic
956393765 3:68802826-68802848 CACGTAACCTTTAAAAAACAGGG - Intronic
956563833 3:70613679-70613701 AAACTATCTTTTAAGAAAAAGGG - Intergenic
957237291 3:77610848-77610870 CAGATAACCTTAAAGAAAAGAGG - Intronic
958458623 3:94365621-94365643 CAGATATCCTTTAAGAACACAGG + Intergenic
958880895 3:99668046-99668068 CAGCTAAGCATTCAGTAAAAGGG + Intronic
959049478 3:101511491-101511513 CACCAAACCTCTAAGTAAAATGG - Intronic
960771913 3:121202748-121202770 CAGCTAACTTTTAGAAACAATGG - Intronic
961306673 3:125962661-125962683 CAGCAAGGCTTTAAGAGAAAGGG + Intergenic
965334297 3:167417380-167417402 CAATTAAACTGTAAGAAAAAAGG + Intergenic
965482661 3:169239203-169239225 TTGATTACCTTTAAGAAAAAAGG - Intronic
966708219 3:182941212-182941234 AAGCAAATATTTAAGAAAAATGG + Exonic
966754149 3:183352753-183352775 CAACTAACTTATTAGAAAAAAGG + Intronic
966957383 3:184896983-184897005 CAGCTAGCATTTAAAAAAAAAGG + Intronic
967258935 3:187622805-187622827 CAACTAAACTTAAAAAAAAATGG - Intergenic
967529001 3:190528019-190528041 AAGCAAACATTTAAGAAGAAAGG - Intronic
967945191 3:194798499-194798521 CAGCTGACCTTTCAGAGACAGGG - Intergenic
969405664 4:6989803-6989825 CAGCTAAGGTTGAAGAAAAAAGG - Intronic
970469807 4:16366338-16366360 TAGCTCACATTTAAGAAATAAGG + Intergenic
970597665 4:17614851-17614873 CAGTTCACGTTTCAGAAAAAAGG - Intronic
971511823 4:27435944-27435966 CATCTGTCCTTTGAGAAAAAGGG + Intergenic
971971364 4:33624627-33624649 CAGCTAACAATCAAGAGAAAAGG + Intergenic
974492233 4:62581305-62581327 AAGCTAAAATTAAAGAAAAATGG - Intergenic
975495697 4:75033970-75033992 CAGCTTACTCTTAAAAAAAAGGG + Intronic
976631639 4:87243682-87243704 AAGCTAACCTTTAAAAATGAAGG + Intergenic
978752039 4:112260507-112260529 CAGCTACCTTTTAAGAAATGTGG - Intronic
980311169 4:131130702-131130724 CAGCCAACCTGTAATGAAAATGG - Intergenic
981152607 4:141396550-141396572 CAACTAACATTAAAGAAAAGAGG - Intergenic
984428292 4:179615773-179615795 TAGCTAACCTTCAAGAAATAAGG + Intergenic
984438934 4:179740933-179740955 CAGCTGATGTTTAAGAATAAAGG + Intergenic
988812596 5:34800261-34800283 TAGATAGCCTTTAAGTAAAAGGG + Intronic
988886810 5:35566943-35566965 CAGCTCCTCTTTAAGAACAATGG - Intergenic
990096994 5:52128373-52128395 CATCTGACCTTTGAGAAAGAAGG + Intergenic
990571016 5:57078868-57078890 CAGCTAACCCCTAAAAAACATGG - Intergenic
990581172 5:57168928-57168950 CAGCATACTATTAAGAAAAATGG - Intergenic
991156654 5:63444407-63444429 CAGCTAATGTTAAAGAAAACTGG - Intergenic
993335814 5:86657230-86657252 CTGCTAAGCTTTATAAAAAATGG - Intergenic
994115950 5:96061485-96061507 CAGCTAACAGAGAAGAAAAAAGG + Intergenic
994924428 5:106096198-106096220 AAGCTAAACCTGAAGAAAAATGG - Intergenic
995197504 5:109388566-109388588 CAGCTAAACTTCCAGAAGAAGGG + Intronic
995668792 5:114575887-114575909 CAGCCAACTTTTAAGAATAGAGG - Intergenic
996292143 5:121864227-121864249 CAGGTAACATTTATAAAAAATGG + Intergenic
1001467277 5:171978670-171978692 CAGCTGGCTTTTAACAAAAATGG + Intronic
1002692066 5:181056955-181056977 CAGCCATCCCATAAGAAAAATGG - Intronic
1003495525 6:6660404-6660426 CAGCTTATCTTTTAGGAAAAGGG + Intergenic
1004040866 6:11973740-11973762 CAGCTAACCTTACAGAAAGATGG + Intergenic
1008275812 6:49542885-49542907 CAGATAACCTCTGAGAGAAAGGG + Intergenic
1010346767 6:74819694-74819716 CAGATAACCTTGAAATAAAAAGG + Intergenic
1011353423 6:86447892-86447914 CAGCTAAAATTAAAAAAAAAAGG - Intergenic
1012697188 6:102401367-102401389 CACCTAACCTTTGGGAGAAATGG + Intergenic
1014159019 6:118145646-118145668 AAGCCAATCTTTAATAAAAATGG - Intronic
1014564530 6:122931423-122931445 CAGCTAACCCTTGAGAAATACGG + Intergenic
1015155328 6:130088580-130088602 CAGATGACATTGAAGAAAAATGG + Intronic
1015550376 6:134405903-134405925 CAGCCAACCTCTCAGAAAATAGG - Intergenic
1019788943 7:2997837-2997859 CAGATAGACTTTAAGAGAAATGG - Intronic
1020567545 7:9817197-9817219 CCTCTTACCTTTAAGAAAACAGG - Intergenic
1020975034 7:14995508-14995530 GTGATAACCTTAAAGAAAAAGGG - Intergenic
1021188457 7:17592757-17592779 TAGCTAATGTTTAAGAAGAAAGG + Intergenic
1023536296 7:41215753-41215775 TATTTAACCTTTAAGCAAAATGG - Intergenic
1025062896 7:55826490-55826512 AAGCTGTCCTTTAAGAATAAAGG + Intronic
1027569203 7:79841982-79842004 AATAGAACCTTTAAGAAAAAAGG + Intergenic
1027955020 7:84866604-84866626 CAGAGAATCTTGAAGAAAAATGG - Intergenic
1028937295 7:96480366-96480388 CAGCTAAGCTCTGAGAAAGATGG + Intergenic
1031947105 7:127853735-127853757 CAGAAAACCTTAAATAAAAAGGG - Intronic
1032301350 7:130690251-130690273 CATCTACCCTTCATGAAAAAAGG + Intergenic
1032943840 7:136827155-136827177 CAGGTAATTTATAAGAAAAAAGG - Intergenic
1032997937 7:137469261-137469283 CAGTCAAGCTTTAAGAAAAGAGG + Intronic
1034190552 7:149210325-149210347 AAGCCAACATTCAAGAAAAAGGG - Intronic
1034855473 7:154542062-154542084 CAGCAAACCTTTTAATAAAAAGG - Intronic
1038414039 8:27380258-27380280 CTGCTATCCTTTCAGAAGAAAGG - Intronic
1041571072 8:59337349-59337371 CAGCTAACCTTGAATAACCATGG - Intergenic
1042404820 8:68392030-68392052 CAGCTACCCTTTACCAACAAAGG - Intronic
1044277640 8:90321195-90321217 CAGCTAAACTCTAAGAGAACAGG - Intergenic
1044346879 8:91115338-91115360 CAGGTAACATATGAGAAAAAGGG + Intronic
1045333327 8:101176465-101176487 CAGCAAAGCTTTGATAAAAAGGG + Intergenic
1045846917 8:106647948-106647970 CTGCAAATCTTTAAGCAAAATGG - Intronic
1046403014 8:113731800-113731822 TAGCTACCCTTAAAGAATAAAGG + Intergenic
1046549835 8:115701670-115701692 TAGATAACCTTTAAGCAAAAAGG - Intronic
1048379513 8:133852753-133852775 CAGCTATCCTGTCAGTAAAATGG + Intergenic
1048831015 8:138477558-138477580 CAGCTTACATTTACAAAAAATGG - Intronic
1050175205 9:2863161-2863183 TAACTTACCGTTAAGAAAAATGG + Intergenic
1050247106 9:3702492-3702514 CAGTTAAAATTTAAAAAAAATGG - Intergenic
1051158836 9:14183075-14183097 CAACTAACTTTTAGGAAGAAAGG + Intronic
1051186465 9:14466145-14466167 CAGCCAGCCTTTATGAAGAAAGG + Intergenic
1051623238 9:19073945-19073967 AAGTTAAAATTTAAGAAAAAGGG + Intronic
1055549452 9:77418118-77418140 ATTCTAACCTTCAAGAAAAATGG - Exonic
1055905600 9:81290626-81290648 CACATAAACTTAAAGAAAAAGGG - Intergenic
1056058832 9:82861115-82861137 CAGCAAACCTGAAAGGAAAAAGG + Intergenic
1057017844 9:91669304-91669326 CAACTAAACTTTAAAAATAATGG - Intronic
1057876305 9:98757046-98757068 AAGCTAACCAATGAGAAAAAGGG - Intronic
1058596049 9:106616948-106616970 CAGCAAACCTTTATGGAGAAAGG - Intergenic
1060363492 9:122984099-122984121 CCTCTAGCCCTTAAGAAAAAGGG - Intronic
1060719281 9:125964406-125964428 CAGCTTACCTTTTAGAGAAGAGG + Intronic
1186595797 X:10980273-10980295 CAGGTAACCTTTGAAAGAAAGGG + Intergenic
1188361205 X:29256284-29256306 CAGCAATCCTTTGTGAAAAAGGG - Intronic
1188443952 X:30237610-30237632 CAGCTATCATCTAAGGAAAATGG + Intergenic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1193019964 X:76781017-76781039 CAGCTTACCTTGACTAAAAAAGG + Intergenic
1193848073 X:86499612-86499634 CTGCTAAATGTTAAGAAAAATGG + Intronic
1194768675 X:97873483-97873505 CAGCTCACCTCTATGAACAAAGG - Intergenic
1194969183 X:100324094-100324116 TACTTAAACTTTAAGAAAAATGG + Intronic
1195793247 X:108613760-108613782 CAGTTATCCTTTTTGAAAAAAGG - Intronic
1196018190 X:110961693-110961715 CAGCTAAGCTTCTTGAAAAAAGG + Intronic
1196043285 X:111229196-111229218 CAGCCAACCTTGGAGTAAAAAGG + Intergenic
1196337371 X:114553320-114553342 CAGCTAACCTTTATGAGTGAAGG - Intergenic
1197011354 X:121568403-121568425 CAACTTAGCTTGAAGAAAAAGGG - Intergenic
1197298162 X:124745213-124745235 CAGCACAACTTTAAGAACAAAGG + Intronic
1197519113 X:127475000-127475022 CACATAACCTTAAAGTAAAAGGG + Intergenic
1198634886 X:138686090-138686112 CTGCTAACTTTTAAGAAAAAAGG + Intronic
1199168559 X:144707542-144707564 CAGCTGACCTTGAACAACAATGG + Intergenic
1200440973 Y:3211762-3211784 TAGCTAAGCTTCAAGAATAAGGG - Intergenic
1201459294 Y:14204705-14204727 TAGAAAACCTTTATGAAAAATGG - Intergenic