ID: 908366386

View in Genome Browser
Species Human (GRCh38)
Location 1:63427741-63427763
Sequence GTTGTGGTAAGGAGGTTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908366377_908366386 10 Left 908366377 1:63427708-63427730 CCACAATTGAATCCCAAAGGTAC No data
Right 908366386 1:63427741-63427763 GTTGTGGTAAGGAGGTTACAGGG 0: 1
1: 0
2: 0
3: 5
4: 122
908366375_908366386 26 Left 908366375 1:63427692-63427714 CCTTCTTTGAGCATTGCCACAAT 0: 1
1: 0
2: 2
3: 13
4: 150
Right 908366386 1:63427741-63427763 GTTGTGGTAAGGAGGTTACAGGG 0: 1
1: 0
2: 0
3: 5
4: 122
908366381_908366386 -3 Left 908366381 1:63427721-63427743 CCAAAGGTACTGGAGCAGGAGTT 0: 1
1: 0
2: 1
3: 9
4: 134
Right 908366386 1:63427741-63427763 GTTGTGGTAAGGAGGTTACAGGG 0: 1
1: 0
2: 0
3: 5
4: 122
908366380_908366386 -2 Left 908366380 1:63427720-63427742 CCCAAAGGTACTGGAGCAGGAGT No data
Right 908366386 1:63427741-63427763 GTTGTGGTAAGGAGGTTACAGGG 0: 1
1: 0
2: 0
3: 5
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908366386 Original CRISPR GTTGTGGTAAGGAGGTTACA GGG Intronic
906303062 1:44697746-44697768 GGTGGGGTGAGGAGGTGACAGGG - Intronic
908366386 1:63427741-63427763 GTTGTGGTAAGGAGGTTACAGGG + Intronic
911071650 1:93836480-93836502 TTTGTGGTAAGGTTGTTAGAAGG - Intronic
912952800 1:114132115-114132137 GTTGTGGTGAGGATGAAACATGG + Intronic
913968956 1:143399448-143399470 ATTGTGATGAGGAGGTTACCGGG + Intergenic
914063334 1:144225047-144225069 ATTGTGATGAGGAGGTTACCGGG + Intergenic
914115816 1:144741307-144741329 ATTGTGATGAGGAGGTTACCGGG - Intergenic
915492878 1:156261226-156261248 CTTGGGGTAAGGAGGTTAATGGG - Intronic
917233449 1:172863617-172863639 GTTGTAGTAGTGAGGTTACCTGG - Intergenic
922746218 1:228045659-228045681 GTTGTGTTAGGGAAGTAACATGG + Intronic
923554055 1:234986774-234986796 GTTCTTGTAAGGAGGGCACAGGG - Intergenic
1062974648 10:1674605-1674627 GTTGCGGTTGGGAGGTCACAGGG + Intronic
1063349198 10:5338532-5338554 ATGGTGGTGAGGAGGTTGCAGGG - Intergenic
1064452380 10:15454188-15454210 TTCATGGAAAGGAGGTTACAGGG - Intergenic
1067879184 10:50029055-50029077 GTTGTGGGGAGGAGGTTTCTGGG + Intergenic
1070747746 10:78945002-78945024 GTTGTGCTTAGGAGGCTGCAAGG - Intergenic
1070778035 10:79121505-79121527 GTTGTGGAGAGGAAGTTACTAGG - Intronic
1074669096 10:115767421-115767443 GTTGTGGTATGCAGGATCCATGG - Intronic
1077877166 11:6318889-6318911 GATGTGGGAAGGCAGTTACAAGG - Intergenic
1080008350 11:27432842-27432864 GTTGTGGTGGGGAGGATATACGG - Intronic
1086453684 11:86941339-86941361 TTTGTGGGAAGGAGGGTAGAGGG + Intronic
1087229699 11:95646573-95646595 TTTGTGATAAGAATGTTACATGG - Intergenic
1088754063 11:112871294-112871316 ATTGGGGTAAGGAGTATACAAGG - Intergenic
1091624740 12:2113327-2113349 GTTCTGGAAAGCAGGTCACATGG + Intronic
1092507128 12:9114087-9114109 GTTGTGGTAAGCAGCTAATAAGG + Intronic
1095258166 12:40065653-40065675 GTTGTGGTAGAGAAGTTATAAGG - Intronic
1096996650 12:55842450-55842472 GTGGAGGTAAGCAGGTTAAAAGG + Intronic
1097907638 12:64936732-64936754 GATGTGGTGAGAAGCTTACATGG + Intergenic
1098025056 12:66192759-66192781 ATTGTGGTAAGCATTTTACATGG + Intronic
1099018678 12:77376593-77376615 GTTGTGGCAAGGGCATTACAGGG - Intergenic
1101877519 12:108605687-108605709 GTGGTGGTTAGGTGGTTAGATGG + Intergenic
1103011314 12:117460582-117460604 GTTGTGGAAGGGAGGGTGCAGGG - Exonic
1103203689 12:119110945-119110967 GCAGTGGTGAGGAGGTTCCAAGG - Intronic
1104831593 12:131756049-131756071 GTTTTGGTGAGGAGATGACATGG + Intronic
1106275085 13:28197039-28197061 GTGGTGGTAAGGATATTAGAAGG + Intronic
1113786471 13:113004478-113004500 GTTATGTTATGGAGGCTACAGGG - Intronic
1115593196 14:34884223-34884245 GTTGTGGTAAGGAAATGAGATGG - Intergenic
1117498932 14:56332597-56332619 GAAGTGGTCAGGATGTTACAGGG + Intergenic
1118899993 14:69978562-69978584 TTTGTGCTAATGAGGTGACAAGG - Intronic
1122754830 14:103970159-103970181 GTTGTGGCAAGGAGGGGCCATGG + Intronic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1125520169 15:40344009-40344031 GATGGGGTAAGGAAGCTACAGGG + Intergenic
1126868127 15:52958237-52958259 TTTGTGGAAAGCAGGTTATATGG + Intergenic
1129109616 15:73329859-73329881 GTTGAGGTGAGGAGGTGGCAGGG - Intronic
1129378769 15:75152529-75152551 ATGGCTGTAAGGAGGTTACATGG - Intergenic
1130624784 15:85503114-85503136 GTCGTGGTAAGGGGATTAAATGG + Intronic
1137841497 16:51644832-51644854 GTTGTAGGAAGGACGTCACATGG - Intergenic
1139263728 16:65620625-65620647 GTTGAGATAAGGAGGTGATACGG - Intergenic
1140037827 16:71384430-71384452 GTTGGGGGAAGGAGGGTGCAGGG - Intronic
1141752811 16:85970431-85970453 CTGGTGGTAGGGAGGTTCCACGG - Intergenic
1143502539 17:7347602-7347624 GTGGTGGAAGGGAGGTGACATGG + Intronic
1143684079 17:8499905-8499927 GGTGTAGTAAGGTGGTCACATGG + Intronic
1143850065 17:9804309-9804331 TTTGTGGTAAGGAGGAGACTGGG - Intronic
1147185212 17:38709613-38709635 GCTGTGGTAAGATGGTTAGAGGG + Intronic
1148386736 17:47239476-47239498 GATGTTGTGAGGATGTTACAAGG + Intergenic
1149684635 17:58528282-58528304 GTTGAGATAGGGAGGTTAGAGGG + Intronic
1150103153 17:62441677-62441699 GTTGAGGCAAGCAGATTACAAGG - Intronic
1150479748 17:65499978-65500000 GTGGTGGTAAGGTGGTTGTAGGG + Intergenic
1159895359 18:73991017-73991039 GTTGTGTTGAGGAGGTGACAGGG + Intergenic
1162638749 19:11990504-11990526 CTTGTGGTAATGGGGTTAGAAGG + Intergenic
1163861101 19:19743317-19743339 GGAGTGGCAAGGAGGTGACATGG + Intergenic
925338327 2:3115001-3115023 GTTGGGCTGAGGAGGTTACGGGG - Intergenic
928630039 2:33181738-33181760 CTTGTGGTACGCTGGTTACAAGG - Intronic
933292701 2:80455141-80455163 GTTGGGGTAATGAGGTGTCAGGG + Intronic
934173659 2:89560368-89560390 ATTGTGATGAGGAGGTTACCGGG + Intergenic
934283973 2:91634717-91634739 ATTGTGATGAGGAGGTTACCGGG + Intergenic
941510975 2:166409008-166409030 GTTATGGTAGGGAAGTCACAGGG - Intronic
945223624 2:207509483-207509505 GGTGGGGTGGGGAGGTTACATGG + Intergenic
948015595 2:234688123-234688145 GGTGTGGTGAGGTGGTGACATGG - Intergenic
1171414487 20:24968418-24968440 GCTGTGGTGACTAGGTTACAGGG + Intronic
1173103566 20:40110260-40110282 GTTCTGGGAAGGAGGTGTCAGGG + Intergenic
1173430930 20:42986676-42986698 ACTGTGGGAAGGAGTTTACATGG + Intronic
1177849775 21:26332796-26332818 GTTGGGGTAAGGGTGGTACAAGG - Intergenic
1181767857 22:25104633-25104655 GTTGAGGAAAGAAGGTCACAGGG - Intronic
1183466504 22:37982985-37983007 GCTGTGGTCAGGAGGATACGAGG - Intronic
952371944 3:32731082-32731104 GTTGTGGTAATCAATTTACATGG - Intronic
954875411 3:53800002-53800024 GTTTTGCAAAGGAGGTTACGGGG + Intronic
956290003 3:67651244-67651266 GGTCTGCTAAGGAGGTTTCAGGG - Intronic
958745732 3:98131585-98131607 GTTATATTAAGGAGGTAACAAGG - Intergenic
960886130 3:122396944-122396966 GTTGGGGGAAGGAGGAAACAGGG + Intronic
961625728 3:128262357-128262379 GTTGTGCTAAGGTGTTAACAGGG - Intronic
965692671 3:171374215-171374237 ATTGGGGTAAGGAGGATAGAGGG - Intronic
966695075 3:182781098-182781120 GGTGTGGTATGGAGGATACTTGG + Intergenic
967065005 3:185907402-185907424 GTTGCAGTAAAGAGGTTACATGG + Intergenic
969620313 4:8275582-8275604 GTTGTGGAGAGGTGGGTACAAGG + Intronic
969708807 4:8831071-8831093 GATGTGGTCAGGAGTCTACAAGG - Intergenic
969827512 4:9769197-9769219 ATTGTGATGAGGAGGTTACCGGG + Intergenic
970682836 4:18531102-18531124 TTTGTGGAAAAGAGGTTATAGGG + Intergenic
970699306 4:18715758-18715780 GTTGGGATAAGGAGCTCACAGGG + Intergenic
973100019 4:46254945-46254967 GTTATGGTAAGGAGGTAACCAGG - Intronic
976708211 4:88041204-88041226 GTTGGGGCAAGGAGGAAACATGG - Intronic
977156527 4:93580816-93580838 TTTGTGGTATGGGGGTTACTGGG - Intronic
977571430 4:98633217-98633239 GCTGTACTAAGGAGATTACAAGG - Intronic
981593562 4:146392816-146392838 GTTTTGTTAAGGAGGTATCAGGG - Intronic
981970011 4:150655999-150656021 TTTGTGGGGAGGAGGTTAGAGGG + Intronic
982337734 4:154258751-154258773 GGTGGGGTAAGGCGTTTACATGG - Intronic
984082395 4:175263790-175263812 GTTGTTGAAAGCAAGTTACAAGG + Intergenic
990797148 5:59556431-59556453 GGTGAGGCAATGAGGTTACATGG + Intronic
992430058 5:76701806-76701828 GGTGTTGTCAGGAGGTTTCATGG - Intronic
993076172 5:83234516-83234538 TCTGTGGTAGGGAGGTTAAATGG - Intronic
993593402 5:89824098-89824120 GTGGTGGTAAAGAGGTGAAAAGG - Intergenic
1000385109 5:160667868-160667890 GTTGGGGTAGGGAGGCTAAAGGG + Intronic
1006272804 6:32977181-32977203 GTTGGGTTAAGGAAGTTATAGGG + Intronic
1007084262 6:39132125-39132147 TTTGTGGTAAGGTTGTTAGAAGG + Intergenic
1009055665 6:58331889-58331911 TTTGTTGTACGGAGGTTAGAGGG - Intergenic
1014114385 6:117655838-117655860 GTAGGGGAAAGGAGGTTAGAAGG + Intergenic
1015707632 6:136105605-136105627 GTTGTTGTAAGGAAATTATAAGG - Intronic
1021646994 7:22798355-22798377 ATTGTGGTGTGGTGGTTACAGGG + Intergenic
1022447881 7:30484718-30484740 TTTGTGGTAAGGCTGTTAGAAGG - Intergenic
1023890288 7:44386971-44386993 CTTGTGGTCAGAAGGTTAGAAGG - Intronic
1024063345 7:45714711-45714733 GTTGTGGAGAGGGGGTCACAGGG - Exonic
1024620536 7:51153711-51153733 GCTGTGGTAAGGAGGCCGCAGGG + Intronic
1030186102 7:106763814-106763836 GTTGGGTTGAGAAGGTTACATGG - Intergenic
1032656729 7:133938384-133938406 GTTGTTGTAAGGAGGAAAAAAGG - Intronic
1033408587 7:141094970-141094992 CTTGTTGTGGGGAGGTTACAAGG - Intronic
1039301049 8:36209124-36209146 GTTGAGGTCAGGAGGTGACTGGG - Intergenic
1043934942 8:86132067-86132089 GTTGTGATAAGGAGGTGATAAGG - Intronic
1046056482 8:109084525-109084547 GTTGTGGTCAGGAGTTTGTAGGG - Intergenic
1048955386 8:139531747-139531769 CTTGAGGTAAGAAGGTTACATGG + Intergenic
1055513087 9:77014257-77014279 TTTGAGGGAAGGAGGATACAAGG - Intergenic
1057740870 9:97710312-97710334 TATGTGGTTAGGAGGTTCCAAGG - Intergenic
1059752281 9:117259130-117259152 TTTGAGGTCAGGAGCTTACATGG - Intronic
1185834390 X:3331361-3331383 GTTGTGGTCAGGAGGCTATTTGG + Intronic
1189851895 X:45186096-45186118 TTTGTGGCAAAGAGGTTACTTGG - Intronic
1193964922 X:87973435-87973457 GTTGCAGTAATGAGGCTACAGGG + Intergenic
1194722914 X:97361590-97361612 GTAGAGGTAAGGCAGTTACAGGG + Intronic
1196792683 X:119478599-119478621 GTTGTGCTAAGCACTTTACATGG + Intergenic
1198370414 X:135984165-135984187 GTTTTAGCAAGGAGGTTATATGG + Intergenic