ID: 908375432

View in Genome Browser
Species Human (GRCh38)
Location 1:63533554-63533576
Sequence ACATCGAAGGGTCCCCTGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908375428_908375432 -9 Left 908375428 1:63533540-63533562 CCAGTTTGGAAACCACATCGAAG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 908375432 1:63533554-63533576 ACATCGAAGGGTCCCCTGAAAGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908375432 Original CRISPR ACATCGAAGGGTCCCCTGAA AGG Exonic
907180743 1:52567967-52567989 ACTTCTAAGGGATCCCTGAAGGG + Intergenic
908375432 1:63533554-63533576 ACATCGAAGGGTCCCCTGAAAGG + Exonic
909094657 1:71271786-71271808 ACCTGGAAGGGTCTCCTGAGGGG - Intergenic
910708927 1:90158554-90158576 AAAACGATGGGTCCCCAGAAAGG - Intergenic
910734476 1:90437457-90437479 AAATTGAAGGGTAGCCTGAACGG - Intergenic
913177586 1:116288997-116289019 ACAAGGATGGGTCCCCTGGAAGG + Intergenic
913499865 1:119462222-119462244 ACATCAGAGGATCCCCTCAAGGG - Intergenic
916061131 1:161099171-161099193 ACATGGTAGGTTCCCCTGGAAGG - Intronic
1068557060 10:58469986-58470008 ACATCAAAATGTCCTCTGAAGGG + Intergenic
1073453504 10:103623096-103623118 ACAGGGAAGGGTTCCCAGAATGG - Intronic
1075774001 10:124967666-124967688 CCATAGAAGGGTACCCAGAAGGG + Intronic
1076740152 10:132478869-132478891 ACACCGACGGGAGCCCTGAAAGG - Intergenic
1077539309 11:3139157-3139179 TCACCCCAGGGTCCCCTGAACGG - Intronic
1077587177 11:3462683-3462705 ACATCGAAGGCACACTTGAATGG + Intergenic
1078461945 11:11520936-11520958 ACATCGCAGGGTCCACCGTAGGG + Intronic
1082812925 11:57489467-57489489 ACATCGAAGGCACATCTGAAGGG - Intronic
1084243169 11:67836694-67836716 ACATCGAAGGCACACTTGAATGG + Intergenic
1096812680 12:54181845-54181867 ACAAAGTGGGGTCCCCTGAAAGG + Exonic
1098551532 12:71767447-71767469 TCATCGAAGGGTTCCCTAACAGG - Intronic
1111006069 13:82250613-82250635 TCACAGAAGGCTCCCCTGAATGG - Intergenic
1116972420 14:51080384-51080406 GCATGGAAGAGTCCCCAGAAGGG + Intronic
1121379591 14:93451540-93451562 ACATCAGAGGGTCTCCGGAATGG - Intronic
1128630143 15:69256732-69256754 ACATTGATGGGTCCACTGGATGG - Intronic
1130258569 15:82337305-82337327 AAATCCCAGGGTCCTCTGAAGGG - Intergenic
1130596354 15:85252655-85252677 AAATCCCAGGGTCCTCTGAAGGG + Intergenic
1149181028 17:53936652-53936674 ACATTTAAGGCTCCACTGAAAGG + Intergenic
1166952955 19:46442379-46442401 AAATCGAAGGTACCCCTGATTGG + Intergenic
929718683 2:44342488-44342510 ACAGCGAAGGTTCCTCTGGAAGG + Exonic
930395651 2:50820637-50820659 ACATCCCAGGGTCACCTGGATGG - Intronic
1175706336 20:61180339-61180361 ACATGGAAGGGTCACCAGTATGG - Intergenic
1179180148 21:39037869-39037891 ACATCGAATGGTGACCGGAAAGG + Intergenic
1185044752 22:48523319-48523341 ACCCCGTAGGGTCCCCTGGATGG - Intronic
969162097 4:5269311-5269333 ACATAGAAGGGTCTCAGGAATGG + Intronic
969401894 4:6961339-6961361 CCATCAAAGGGTGCCCTGAAAGG - Intronic
969811561 4:9652306-9652328 ACATCGAAGGCACACTTGAATGG - Intergenic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
976776461 4:88711489-88711511 ACAGAGAAGGATCCCCTAAAGGG - Intergenic
996019135 5:118572967-118572989 ACACCGCAGGGTCTCCTGACAGG + Intergenic
1000382431 5:160641192-160641214 ACATTGAAGGGAGGCCTGAAGGG + Intronic
1001600641 5:172926036-172926058 AGATCCCAGGGTCCTCTGAAAGG - Intronic
1021125622 7:16848579-16848601 ACATCAAGCGTTCCCCTGAAGGG + Intergenic
1038360432 8:26869863-26869885 AAATTGAAGAATCCCCTGAAGGG + Intergenic
1047967168 8:130054776-130054798 ACATCGAAGGACAGCCTGAAAGG - Exonic
1052051322 9:23851656-23851678 AGATCCAAGGCTCCCCTTAAAGG - Intergenic
1053007956 9:34616460-34616482 ACACCCAAGGGTCCCCAGGAAGG + Intronic
1055398012 9:75893360-75893382 GCATGGAAGGGTTCCCTAAAAGG - Intronic
1059339529 9:113589693-113589715 GCACTGAAGGGTGCCCTGAATGG + Intronic
1062134794 9:134919680-134919702 ACATCTAAGTGTCCCAGGAAAGG + Intergenic
1187690108 X:21857502-21857524 ACATCGAAGGGGCACACGAAGGG - Exonic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189306673 X:39992047-39992069 ACAACGCTGGGTCCCCTGCATGG - Intergenic
1195435214 X:104835961-104835983 ACATTAAAGGGTCAGCTGAAAGG + Intronic