ID: 908377180

View in Genome Browser
Species Human (GRCh38)
Location 1:63555467-63555489
Sequence TTGTATATAGAGATGAAACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 449}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908377176_908377180 -1 Left 908377176 1:63555445-63555467 CCAGTAACAGATGAAGCCCAACT 0: 1
1: 0
2: 1
3: 5
4: 133
Right 908377180 1:63555467-63555489 TTGTATATAGAGATGAAACAGGG 0: 1
1: 0
2: 2
3: 37
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908377180 Original CRISPR TTGTATATAGAGATGAAACA GGG Exonic
901413463 1:9101226-9101248 TTGTATATTTAGTAGAAACAGGG + Exonic
904585285 1:31576628-31576650 GTGTAGACAGAGAAGAAACAGGG + Intronic
905472037 1:38200199-38200221 TTGTAACAGGAGATGAAACATGG + Intergenic
905573269 1:39023259-39023281 TTGTAATAGGAGATGAAACATGG + Intergenic
905622917 1:39464368-39464390 TTGGATATACTAATGAAACATGG - Intronic
906235189 1:44202569-44202591 TTGTTTATAGAGAGGACACGTGG + Intergenic
906302129 1:44690618-44690640 TGGAATATAGATTTGAAACAGGG - Intronic
907111087 1:51927132-51927154 TTCTAGATTGAGATGAACCAAGG - Intronic
907623194 1:56002904-56002926 TTGTTTAGAGAGATGAATAAGGG - Intergenic
907971326 1:59384423-59384445 TTGCATATCAAGGTGAAACAAGG + Intronic
908377180 1:63555467-63555489 TTGTATATAGAGATGAAACAGGG + Exonic
908412683 1:63882983-63883005 TTGTATGGAGTGATGAAAAATGG + Intronic
911052721 1:93684900-93684922 TTGTATTTTGAGTAGAAACAGGG + Intronic
911834751 1:102603012-102603034 TTATATTTACAGCTGAAACACGG + Intergenic
912910148 1:113750393-113750415 TTGTATTTAGAGAATAAAAAAGG - Intronic
913676328 1:121144331-121144353 TTGTAATGGGAGATGAAACATGG + Intergenic
914028223 1:143932281-143932303 TTGTAATGGGAGATGAAACATGG + Intergenic
917465129 1:175269554-175269576 TTGTATATAAAGACAAATCATGG - Intergenic
919135212 1:193498863-193498885 TTGTTAATAGAGATGATTCAAGG - Intergenic
919356164 1:196524572-196524594 TTGTATTTACATTTGAAACATGG - Intronic
919372357 1:196744090-196744112 TAATATAAAGAGATGAAATAAGG + Intronic
920010421 1:202863034-202863056 ATGTATATAGAGTTAAGACACGG + Intergenic
920463694 1:206163172-206163194 TTGTAATGGGAGATGAAACATGG + Intergenic
921759061 1:218891042-218891064 TTGTATATAGAATTGAAGAAAGG - Intergenic
923269737 1:232344843-232344865 TTGCATAGAAATATGAAACAGGG - Intergenic
923505058 1:234598536-234598558 TTGTATATATAGTAGAGACAGGG + Intergenic
924049144 1:240062791-240062813 TTGTAACAGGAGATGAAACACGG - Intronic
924388092 1:243519379-243519401 TTGTAACAGGAGATGAAACATGG + Intronic
1063342490 10:5280317-5280339 TTGTAAAATGAGGTGAAACATGG + Intergenic
1064321955 10:14313651-14313673 GTGTAAAGAGAGATGCAACAGGG + Intronic
1065697575 10:28393950-28393972 TTGCAGGTAGAGATTAAACAAGG + Intergenic
1066015377 10:31237328-31237350 TTATCTATAAAAATGAAACAAGG + Intergenic
1066695633 10:38075370-38075392 TTGAATACAGAGAAGAAACATGG + Intergenic
1066996903 10:42572193-42572215 TTGAATACAGAGAAGAAACGTGG - Intergenic
1068061797 10:52077430-52077452 TTTTATATAGAGATGACAGATGG + Intronic
1068421715 10:56802736-56802758 TTGTAACAGGAGATGAAACATGG - Intergenic
1068512358 10:57983071-57983093 TTGTACATATAGATCATACAAGG - Intergenic
1069270561 10:66521833-66521855 TTGTAACAGGAGATGAAACACGG - Intronic
1070368902 10:75763044-75763066 TTGAAGATAGACATGAAAAAAGG - Intronic
1071990904 10:91100098-91100120 TTGTGTAAAAAGATGATACAAGG + Intergenic
1072345244 10:94498626-94498648 TTGTATATTTAGTAGAAACAGGG + Intronic
1073220796 10:101871826-101871848 TTGTATATTTAGTAGAAACAGGG - Intronic
1073813166 10:107174051-107174073 TTGTATGTATAGATCAATCAGGG + Intergenic
1075339422 10:121633457-121633479 CTGTAGATAGAGATCACACAGGG - Intergenic
1075502691 10:122990592-122990614 TTGAATAAAGAGAAGAAACTAGG + Intronic
1076232063 10:128828786-128828808 TTGTAACAGGAGATGAAACATGG + Intergenic
1078307089 11:10200107-10200129 TTTTATATACATATGAAACAGGG + Intronic
1078463404 11:11532322-11532344 TTGTAAAAAGAGATGAACGATGG - Intronic
1078842747 11:15093833-15093855 TTGTAACAGGAGATGAAACATGG - Intergenic
1079192149 11:18287971-18287993 GTGTATATGGAGATGGAAAAAGG - Exonic
1079711082 11:23682528-23682550 CTGTATATTGAGATGATACATGG + Intergenic
1080597321 11:33784991-33785013 TGGTATATAGTGTTGAAATAAGG - Intergenic
1081372288 11:42318610-42318632 TTAATTATATAGATGAAACATGG - Intergenic
1082561485 11:54625485-54625507 TTGTATATTTAGTGGAAACAGGG + Intergenic
1082944287 11:58741363-58741385 TAGTATATAAGGATGAAAGAAGG + Intergenic
1082989293 11:59193563-59193585 TTGAATATAGACATCAAATAGGG - Intronic
1083497661 11:63072306-63072328 TTGTAGCAGGAGATGAAACATGG - Intergenic
1085432906 11:76471003-76471025 TTGTATATTGATATGAAGAATGG - Intronic
1085923144 11:80982457-80982479 TCGTCTATAGAGAGGAAACCTGG - Intergenic
1086572822 11:88304923-88304945 TTGTATTTTTAGTTGAAACAGGG - Intronic
1086596555 11:88578977-88578999 TTTTACAGAAAGATGAAACAGGG + Intronic
1086822824 11:91455964-91455986 ATGTTTATTGAGATGAAAAAAGG + Intergenic
1089435754 11:118464691-118464713 TTGTAACAGGAGATGAAACATGG + Intronic
1089975202 11:122725992-122726014 TTCTATAGAAAAATGAAACAAGG - Intronic
1090361280 11:126174695-126174717 TTGAATATATAAATGAAAGATGG - Intergenic
1093128039 12:15353867-15353889 TTGTAACCGGAGATGAAACATGG - Intronic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1093946242 12:25113164-25113186 TTGTATATAGAGAGAAACTAAGG - Intronic
1094021762 12:25921956-25921978 TTGTATTTTTAGAAGAAACAGGG - Intergenic
1094298089 12:28930414-28930436 TTGTAGGTATAGAGGAAACAAGG + Intergenic
1094305088 12:29009485-29009507 CTGTATAAAGAGATGACCCATGG - Intergenic
1094675329 12:32614294-32614316 TTGTAACAGGAGATGAAACATGG + Intronic
1095229149 12:39716527-39716549 TTGTAGCTAGAAATGAAATAAGG - Intronic
1095619352 12:44230404-44230426 TTGGATGTAGAGGTGAAAAATGG - Intronic
1096036865 12:48479759-48479781 TCTTTTATACAGATGAAACATGG - Intergenic
1096478282 12:51921902-51921924 TTGTATATTTAGTAGAAACAGGG + Intronic
1096744584 12:53717237-53717259 TTTTTTGTAGAGATGAGACAGGG + Intronic
1097754665 12:63396284-63396306 TTGAACAAAGAGATGAAGCAGGG + Intergenic
1097974026 12:65665506-65665528 TTGTACATAGTGATGAGAGAGGG - Intergenic
1098547245 12:71725350-71725372 TTGTAACTAGAGATGAAACATGG - Intergenic
1098759670 12:74407343-74407365 TAGTACATAGAGATGAGTCATGG + Intergenic
1098864163 12:75743236-75743258 TTGTAACAGGAGATGAAACAAGG + Intergenic
1100282707 12:93133441-93133463 TTGTAATAGGAGATGAAACACGG + Intergenic
1100860930 12:98806042-98806064 TTGTATATTTAGTAGAAACAGGG + Intronic
1100987727 12:100220157-100220179 TTTTATATAGAAACGAAACATGG + Intronic
1101540799 12:105663309-105663331 TTGTCTATCGATATAAAACATGG - Intergenic
1102754876 12:115330725-115330747 TTGTAACAGGAGATGAAACATGG + Intergenic
1102900437 12:116632484-116632506 TTGTATATATAGTAGAGACAGGG + Intergenic
1103316254 12:120058154-120058176 TTGTAAATTGAGATGAGAAATGG + Intronic
1103662951 12:122536402-122536424 TTGTATTTTTAGAAGAAACAGGG + Intronic
1104787991 12:131462292-131462314 TTGTAACAGGAGATGAAACATGG - Intergenic
1106708181 13:32303513-32303535 TTATATATAGAGATGATGAAGGG - Intergenic
1106819334 13:33445726-33445748 TTGTATATAGAGAGATCACAGGG + Intergenic
1107729372 13:43332838-43332860 ATGTATATACAGAAGAAAAAAGG + Intronic
1107811753 13:44207065-44207087 TTGTATTTAGTGAAGAAATAGGG + Intergenic
1108215802 13:48183177-48183199 CTGTAACAAGAGATGAAACATGG + Intergenic
1108245640 13:48510407-48510429 TTGGAGGTATAGATGAAACATGG + Intronic
1108367291 13:49728560-49728582 TTGTAAAAGGAGATGAAACATGG + Intronic
1108711794 13:53040458-53040480 TTGTATATGGCGATCAAAGAAGG + Intronic
1109523410 13:63543250-63543272 CCGTATATAAGGATGAAACAAGG + Intergenic
1109576467 13:64265139-64265161 TTGTAACAGGAGATGAAACATGG + Intergenic
1109728764 13:66382074-66382096 TGTTATATAAAGATGAAAAAGGG + Intronic
1109737313 13:66503851-66503873 TTATATATATTCATGAAACAGGG - Intronic
1109872178 13:68346345-68346367 ATGTAGATAGACATGGAACAGGG + Intergenic
1110999371 13:82158965-82158987 TTTTATGTAGGGATGAGACAAGG + Intergenic
1111751464 13:92336683-92336705 TGGTATATAGTGATGAAAACAGG + Intronic
1114368551 14:22058121-22058143 TTGGATATAGTTATGAAAAAGGG + Intergenic
1114721136 14:24882972-24882994 TTGTTTATAGTAATGAAATATGG + Intronic
1114753881 14:25236551-25236573 TTGTAACAAGAGATGAAACATGG + Intergenic
1114764363 14:25353833-25353855 TTGCTTATAGAGATAAAACAGGG - Intergenic
1115073500 14:29357219-29357241 ATGTACATAGTGATGAAAGATGG - Intergenic
1115217617 14:31028098-31028120 TTTCATATAGAAATAAAACATGG - Intronic
1115331099 14:32199402-32199424 TTGGAGATAAAGAAGAAACAAGG - Intergenic
1116076165 14:40113752-40113774 TTGAATTTAGAGTAGAAACAGGG - Intergenic
1116431167 14:44846800-44846822 TTGTATTTTTAGAAGAAACAGGG - Intergenic
1116839915 14:49809685-49809707 TTGTATTTTTAGAAGAAACAGGG - Intronic
1116985303 14:51213119-51213141 TTGTGTATAGGCATGAAAGATGG - Intergenic
1117031154 14:51672066-51672088 TTGTAACAAGAGATGAAACATGG + Intronic
1117386537 14:55219686-55219708 TTGTAACAGGAGATGAAACATGG + Intergenic
1117467788 14:56011091-56011113 TTGTAATAGGAGATGAAACATGG + Intergenic
1117989669 14:61421235-61421257 TTGTATATATTGATGACAAAAGG - Intronic
1118467891 14:66047550-66047572 TTGTAACAGGAGATGAAACATGG - Intergenic
1118811574 14:69278728-69278750 TTGTTTATAACTATGAAACACGG - Intronic
1118989931 14:70788796-70788818 TCTTATACAGAGATGAAAAAGGG + Intronic
1119987813 14:79159272-79159294 TTGTAACAGGAGATGAAACATGG - Intronic
1120347126 14:83305175-83305197 TTGTAAATAGAGAACAAACTTGG - Intergenic
1121899975 14:97684970-97684992 TAGTATATAGACAAGAAAGATGG + Intergenic
1122010378 14:98741509-98741531 TTGTAAATAGAGTTTAAAAAAGG - Intergenic
1122498696 14:102178911-102178933 TATTATATAGAGATGAGAGAGGG + Intronic
1202867813 14_GL000225v1_random:134536-134558 CTGTAGATAGAGCTTAAACAAGG - Intergenic
1124552206 15:30692221-30692243 TTGTATTTTTAGATGAGACAAGG + Intronic
1124557798 15:30744081-30744103 TTGGAGATAGAGAAGAAGCATGG + Intronic
1124627553 15:31317355-31317377 TTGCATCTAGAGCTGAAAGATGG - Intergenic
1124673438 15:31661575-31661597 TTGGAGATAGAGAAGAAGCATGG - Intronic
1124679033 15:31713444-31713466 TTGTATTTTTAGATGAGACAAGG - Intronic
1124884208 15:33669682-33669704 TGAGATATAGAGAGGAAACAGGG + Intronic
1125107412 15:35989006-35989028 TGGTATATAGAGCTTTAACAGGG + Intergenic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125547234 15:40514863-40514885 TTGTATTTTGAGTAGAAACATGG + Intergenic
1125772934 15:42183770-42183792 TTGGATAAAGAGACAAAACAAGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127290484 15:57566033-57566055 TTGTATTTTTAGAAGAAACAGGG - Intergenic
1128576441 15:68779005-68779027 TCTTTTATACAGATGAAACATGG + Exonic
1128628157 15:69233378-69233400 CTGAATGTAGAGATAAAACAAGG - Intronic
1129123370 15:73417347-73417369 TTGTATATTTAGTTGAGACAGGG - Intergenic
1130623604 15:85490158-85490180 TTGTTTAGAGAGAGGAAAGATGG + Intronic
1132282432 15:100631946-100631968 TTGTATACAGGGTTGAAACTGGG - Intronic
1134297295 16:12958294-12958316 TTGTTTATAATGATGAAAAATGG - Intronic
1134374400 16:13658176-13658198 TTGTTTATAGATATTACACAGGG - Intergenic
1134898992 16:17917563-17917585 TTGAATGTAGAGATGACACAGGG - Intergenic
1135588087 16:23686387-23686409 TAGTAAAAATAGATGAAACATGG - Intronic
1136151599 16:28354323-28354345 TTGTATTTTGAGTAGAAACAGGG + Intronic
1136167832 16:28468164-28468186 TTGTATTTTGAGTAGAAACAGGG + Intronic
1136195143 16:28646850-28646872 TTGTATTTTGAGTAGAAACAGGG - Intronic
1136211481 16:28760966-28760988 TTGTATTTTGAGTAGAAACAGGG - Intronic
1136256203 16:29040917-29040939 TTGTATTTTGAGTAGAAACAGGG - Intronic
1136309123 16:29395332-29395354 TTGTATTTTGAGTAGAAACAGGG + Intronic
1136467801 16:30457076-30457098 TTGTATTTTCAGAAGAAACAGGG - Intergenic
1137922856 16:52508636-52508658 TTTTATATAAAGAAAAAACAAGG + Intronic
1139060783 16:63248988-63249010 TTGTATAAACAGAAAAAACAAGG + Intergenic
1140136856 16:72213949-72213971 TTGAATATATAACTGAAACAAGG + Intergenic
1140466477 16:75187271-75187293 TTGGGTCTAGAGATGAAATAAGG + Intergenic
1140707815 16:77647225-77647247 TTTTATAAAGACATGAAATAGGG - Intergenic
1140866228 16:79064944-79064966 GTGTTTATAGAGATGGAGCATGG + Intronic
1141106829 16:81241004-81241026 TTGTATTTTTAGCTGAAACAGGG + Intronic
1141152228 16:81572232-81572254 TTGTAGACAGAGATGAGAAATGG - Intronic
1141246922 16:82316628-82316650 TTGTATTTTTAGTTGAAACAGGG + Intergenic
1142671566 17:1489864-1489886 TTGTATTTTTAGTTGAAACAGGG - Intronic
1143413504 17:6727441-6727463 GTGTATATATATATAAAACATGG - Intergenic
1144540812 17:16140639-16140661 TTGTATATTTAGTAGAAACAGGG - Intronic
1145122735 17:20275398-20275420 TACTATATACAGATGATACAGGG - Intronic
1145859105 17:28192494-28192516 TTGTATTTTTAGAAGAAACAAGG - Intronic
1146290913 17:31606526-31606548 TTGTATTTTGAGTGGAAACAGGG - Intergenic
1146488965 17:33266198-33266220 TTGTATACAGAACTCAAACAGGG - Intronic
1146731547 17:35196985-35197007 TTGTATATGGTGTTGAAATAAGG + Intergenic
1148587268 17:48790048-48790070 TTGGATAAAGAGGTGAAAGATGG - Exonic
1149195329 17:54112743-54112765 TTGTAAAAGGAGATGAAACATGG + Intergenic
1151672099 17:75576520-75576542 TTGTATTTTTAGAAGAAACAGGG - Intergenic
1152058113 17:78048390-78048412 TATTATATAGAGGCGAAACATGG - Intronic
1153084313 18:1266169-1266191 TTGTAACTAGTGATGAACCAAGG - Intergenic
1153251040 18:3121944-3121966 TTGTATTTTTAGAAGAAACAGGG - Intronic
1153449114 18:5206761-5206783 TAGTTTATATAAATGAAACAGGG + Intergenic
1153655043 18:7274706-7274728 TTGTATATTTAGTTGAGACAGGG + Intergenic
1153724585 18:7942108-7942130 TTGTATTTAGAGTAGACACAGGG - Intronic
1155005015 18:21720991-21721013 GTGTGGATTGAGATGAAACAAGG + Intronic
1155131107 18:22935249-22935271 TTGGGTGAAGAGATGAAACAAGG - Intronic
1155453357 18:25986020-25986042 TTTTCTATAGAGATGAAAGCAGG - Intergenic
1155561165 18:27078726-27078748 CTGTATAAAGAGCTGAAAAAGGG + Intronic
1155601628 18:27555542-27555564 TTGTAATAGGAGATGAAACATGG + Intergenic
1155753445 18:29458498-29458520 TTGTATTTTTAGTTGAAACAGGG + Intergenic
1155854790 18:30819730-30819752 TTGTAGCAGGAGATGAAACATGG + Intergenic
1156255273 18:35389383-35389405 TTGTAACAGGAGATGAAACACGG + Intergenic
1156421476 18:36958246-36958268 TTGTATATACATATTCAACATGG - Intronic
1156592397 18:38505848-38505870 TTGTAACAGGAGATGAAACATGG - Intergenic
1157768443 18:50323437-50323459 TTGTAACAGGAGATGAAACATGG + Intergenic
1158102847 18:53850009-53850031 TTGTAAACTGAGATGAAACTAGG + Intergenic
1158493625 18:57932959-57932981 TTGTAGCAAGAGATGAAACATGG - Intergenic
1158722745 18:59940244-59940266 TTGTATGTAGAGAAGGAATAAGG - Intergenic
1158728797 18:60000632-60000654 TTGTATTTTTAGTTGAAACAGGG + Intergenic
1159145082 18:64443814-64443836 TGGTATATAGAAAATAAACAGGG + Intergenic
1159198393 18:65149057-65149079 TTGTAACTGGAGATGAAGCAGGG - Intergenic
1159268054 18:66110643-66110665 TTTTATATAGAAAAGATACAAGG + Intergenic
1159521054 18:69524820-69524842 TTGTTTATAGAAAAGAAATAGGG + Intronic
1161889945 19:7027748-7027770 TTGTATTTTGAGTAGAAACAGGG - Intergenic
1161891507 19:7042998-7043020 TTGTATTTTGAGTAGAAACAGGG + Intergenic
1161893592 19:7061455-7061477 TTGTATTTTGAGTAGAAACAGGG + Intergenic
1162551976 19:11362991-11363013 TTCTAAATAAAGATGAATCAAGG + Intronic
1162624142 19:11870427-11870449 TTGTATTTTTAGATGAGACAGGG - Intronic
1163999478 19:21083761-21083783 TTGTACCTAGAGAAGATACAAGG - Intronic
1168092138 19:54093017-54093039 TTGTATTTTGAGTAGAAACAGGG - Intergenic
1168274168 19:55267321-55267343 TTGTATATATAGTAGAGACAGGG + Intronic
925757064 2:7143511-7143533 TTTTATATAAATATGAAACAAGG - Intergenic
925758516 2:7159396-7159418 ATATACATACAGATGAAACATGG - Intergenic
926257655 2:11221535-11221557 TTTTAAATATAGATTAAACAAGG + Intronic
926283438 2:11468660-11468682 TTGTATTTATAGAAGAGACAGGG - Intergenic
926662837 2:15487303-15487325 TTGAACATAGATATGAAACATGG + Intronic
926993832 2:18711914-18711936 ATGTAGCAAGAGATGAAACATGG - Intergenic
927120870 2:19961558-19961580 TTGCAAAAGGAGATGAAACATGG + Intronic
928826086 2:35422917-35422939 ATATATATATATATGAAACATGG - Intergenic
928841465 2:35610529-35610551 TTGTGAATAGAGATTAAATATGG - Intergenic
929389350 2:41451311-41451333 TTGTAAAAGAAGATGAAACATGG + Intergenic
930660597 2:54049086-54049108 TTGTATTTTTAGAAGAAACAGGG - Intronic
931164763 2:59734469-59734491 TTTTATACAGATATGAATCATGG - Intergenic
931615771 2:64155919-64155941 ATATGTATAGATATGAAACAAGG + Intergenic
931851857 2:66259321-66259343 TAGAATATAGAAATGAAATATGG + Intergenic
932030929 2:68183755-68183777 TGGAATATAAAGATGAAACCAGG - Intronic
933653395 2:84867119-84867141 TTATCTCTAGAAATGAAACATGG + Intronic
933807330 2:86009507-86009529 TTGTATATTGAGTAGAGACAGGG - Intergenic
934131362 2:88952383-88952405 AGGCATATAGAGAGGAAACAGGG + Intergenic
934680536 2:96280720-96280742 TTGTATATTTAGTAGAAACAGGG + Intronic
934939560 2:98490514-98490536 TTATATATGGAGATGGAACCCGG + Intronic
936007215 2:108900381-108900403 TTGTATATTTAGTAGAAACAGGG - Intronic
936944258 2:117916391-117916413 TTGAAGTTTGAGATGAAACAAGG - Exonic
936980405 2:118259430-118259452 CTGTATATAGAAATGTAACTTGG + Intergenic
937244458 2:120483613-120483635 CTGTCTAGAGAGCTGAAACAGGG - Intergenic
937748069 2:125439191-125439213 TTGTATTTTTAGATGAGACAGGG - Intergenic
938309781 2:130281697-130281719 TTGTTTGTAGGGATGAAGCAGGG - Intergenic
938784713 2:134616026-134616048 TTGTAAAAAGAGATGAGACGTGG + Intronic
939063867 2:137458436-137458458 TTGTAACAGGAGATGAAACATGG - Intronic
939291202 2:140197157-140197179 TTGTAACAAGAGATTAAACATGG - Intergenic
939544091 2:143530890-143530912 TTGTATCATGAAATGAAACAAGG - Intronic
940516434 2:154689861-154689883 TAGTAGATAGAGATGAGAGAAGG + Intergenic
941254030 2:163205486-163205508 TGGTATATTGAGAAGATACATGG + Intergenic
941540489 2:166776975-166776997 ATGTATATAGAGAAGAGGCAGGG + Intergenic
941601657 2:167550566-167550588 TTGGATGTAGAGAGGAAACATGG + Intergenic
942303341 2:174583531-174583553 TAGAATATAGAGATGAAGAAAGG - Intronic
943922978 2:193733739-193733761 TTGAATAGACAGATGTAACAAGG + Intergenic
944753581 2:202736586-202736608 TTGTATATTTTGATGAGACAGGG - Intronic
945538822 2:211056605-211056627 GTGCAGATAGAGATGAAAAATGG - Intergenic
946151567 2:217776397-217776419 TTGTAACAGGAGATGAAACAGGG - Intergenic
947344333 2:229175006-229175028 GTGTATATGGAGAGAAAACAGGG + Intronic
947764400 2:232627524-232627546 TTGGATATATAGCTGAAAAAAGG - Intronic
1170332580 20:15230459-15230481 ATGTACATAGAGATTAAACATGG - Intronic
1171535927 20:25889212-25889234 TTGTATTTTTAGTTGAAACAGGG - Intergenic
1172669605 20:36625950-36625972 TTGTATTTTGAGTAGAAACAGGG - Intronic
1172968325 20:38855187-38855209 CTGTCTTTAGAGATGACACATGG - Intronic
1173905024 20:46620928-46620950 TTGTAACAGGAGATGAAACATGG + Intronic
1174488988 20:50879012-50879034 CTGTATAAAGAGAGGACACACGG + Intronic
1175283072 20:57818497-57818519 TTTTATCTACAGATGAGACATGG + Intergenic
1177449151 21:21243065-21243087 TAGAATGTAGAGATGAAGCAGGG + Intronic
1177815529 21:25972182-25972204 TTGTATATAGAAATTTAACCTGG - Intronic
1177994869 21:28084520-28084542 TTGTAACAGGAGATGAAACATGG - Intergenic
1181503091 22:23330900-23330922 TTGTATGTAGATATGCAACCTGG + Intergenic
1181653898 22:24279276-24279298 TTGTATGTAGATATGCAACCTGG + Intronic
1182205488 22:28620565-28620587 TTGTAACCAGAGATGAAACATGG + Intronic
1184131034 22:42516483-42516505 TTGTATTTTGAGAAGAGACAGGG + Intronic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
949147205 3:716363-716385 TTTTATATAAAGATGAAATATGG + Intergenic
952441329 3:33332778-33332800 TTGTGTATAGAAAAGATACAGGG + Intronic
953409479 3:42682245-42682267 GTGGAGATAGAGATGAAACAGGG + Intergenic
955021091 3:55121933-55121955 TTGTATATTTAGTAGAAACAGGG - Intergenic
955514851 3:59716405-59716427 TTGTAAATAGGGATGAAACCAGG - Intergenic
955579239 3:60401227-60401249 ATGTATATGGAGGTGAAACTTGG - Intronic
956151640 3:66249812-66249834 TTGTATATAAAGATGAATGAAGG + Intronic
956220944 3:66902478-66902500 TTGTATTTTTAGTTGAAACAGGG - Intergenic
956998738 3:74859055-74859077 TTGTATGTTGAGATGAACGAGGG + Intergenic
957271108 3:78031128-78031150 TTCATTATAGAGAGGAAACAAGG - Intergenic
957421591 3:79978644-79978666 GTTTATTTAGAGATTAAACATGG - Intergenic
957500052 3:81044351-81044373 TAGTACATGGATATGAAACACGG + Intergenic
957762854 3:84581910-84581932 ATGTAACAAGAGATGAAACATGG + Intergenic
958076138 3:88681115-88681137 ATATATCTAGAGATGAAGCAAGG + Intergenic
958494576 3:94828566-94828588 TTGTATTTTGAGTAGAAACAGGG + Intergenic
958896090 3:99831142-99831164 TTGTTTATAATGATGAAAAATGG + Intronic
959007106 3:101032306-101032328 TTGTAATAGGAGATGAAACATGG + Intergenic
959217569 3:103471824-103471846 TTGTAACCAGAGATGAAACATGG - Intergenic
960209234 3:114939404-114939426 TTGAAAATAGAGATAAAATATGG + Intronic
960315525 3:116171649-116171671 TTGGATTTAGAGATGACTCAAGG - Intronic
960735895 3:120780360-120780382 TTGAATAAAGACATGAAAGATGG + Intronic
961159344 3:124709448-124709470 TTGTATATTTAGTAGAAACAGGG + Intronic
961928961 3:130513509-130513531 TTGTAATGAGAGATGAAACGTGG + Intergenic
961936292 3:130587432-130587454 TTGTATATTTAGTAGAAACAGGG + Intronic
962346446 3:134622774-134622796 TTCTCTACAGAGATTAAACATGG - Intronic
962646185 3:137443014-137443036 TTGTAACAAGAGATGAAACATGG - Intergenic
963431942 3:145218037-145218059 TTGTATATAAATATAAAACCTGG + Intergenic
965758415 3:172049373-172049395 TTTAATATTGAGATGAATCAGGG + Intronic
966483270 3:180436535-180436557 TTGTAGATAGAAATGGAAAATGG + Intergenic
966660649 3:182410987-182411009 TGGTATAGAAAGAGGAAACAAGG + Intergenic
966751949 3:183330743-183330765 TTCTATATAGTGAAGAAAAAAGG + Intronic
968027158 3:195451979-195452001 TTGTACATAGTGTTGGAACAGGG + Intergenic
969598909 4:8164177-8164199 CTGTATTTAGAGATGAAGAAAGG - Intergenic
969938496 4:10706784-10706806 TTGTTTATAGACATCATACAGGG - Intergenic
970480991 4:16474325-16474347 TTGTAACAAGAGATGAAACTTGG + Intergenic
970628252 4:17913367-17913389 TTGTAAAAGGTGATGAAACACGG + Intronic
970951696 4:21764482-21764504 ATTTATATAAAAATGAAACAAGG + Intronic
972185633 4:36524459-36524481 TGGTTTATACAGAAGAAACAGGG - Intergenic
972384214 4:38548349-38548371 TAGTATTTATGGATGAAACAAGG + Intergenic
972654845 4:41054673-41054695 TTATATAGAGAGAAGAACCAAGG - Intronic
972944186 4:44233638-44233660 TTCTATATAAAAATAAAACAAGG - Intronic
974084786 4:57248226-57248248 TTATATATATATATAAAACATGG + Intergenic
974469957 4:62306156-62306178 TTGTATGTATAGATACAACATGG - Intergenic
974743578 4:66040487-66040509 TTGTCTCTATAGATGAAAGAGGG - Intergenic
976235698 4:82894308-82894330 TTGTAACAGGAGATGAAACATGG - Intronic
976519553 4:86010289-86010311 TTGCTTAAAGCGATGAAACAAGG - Intergenic
976528589 4:86122479-86122501 TTGTAACAGGAGATGAAACATGG - Intronic
976857436 4:89621735-89621757 TAGTAGATAGAGAAGAAAGAAGG + Intergenic
977001552 4:91511000-91511022 TTGTATATGGCGATAAAAAAGGG + Intronic
977664604 4:99631496-99631518 TTGTATTTTGAGAAGAGACAGGG - Intergenic
977788250 4:101066245-101066267 TTCTTTAAAGAGATTAAACATGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
978103208 4:104868799-104868821 ATGTATATATATATGAGACAAGG + Intergenic
978293687 4:107177079-107177101 ATGGAAATAGAGATGAAAGATGG - Intronic
978436588 4:108692163-108692185 TTTTATATATAAATGAATCAGGG + Intergenic
980063177 4:128153991-128154013 TTCTATAGAGAGATGACGCATGG - Intronic
980416351 4:132493714-132493736 TTAAATATAGAGCTGACACAAGG - Intergenic
980563333 4:134505060-134505082 TTGTCTACAGATAAGAAACATGG - Intergenic
981220402 4:142225692-142225714 TTGTATATAGGAATGAAAGGGGG + Intronic
983527842 4:168778386-168778408 TTGAATATAGTGATTATACAAGG - Intronic
985067504 4:186137595-186137617 TTTTTTATAGTGATGAAAGAGGG + Intronic
985246181 4:187981971-187981993 GTGTATAAACAGATGAAATATGG + Intergenic
985909133 5:2865244-2865266 TTGTTTGTAGAGAGAAAACAGGG - Intergenic
986378015 5:7152424-7152446 TTGTAAGAAGAGATGAGACAAGG - Intergenic
987320304 5:16762787-16762809 TTGTATATTTAGTAGAAACAGGG - Intronic
988346016 5:30038858-30038880 TTGTAACAAGAGATCAAACATGG - Intergenic
988729451 5:33956318-33956340 TTGTAACAGGAGATGAAACATGG + Intronic
988814587 5:34821557-34821579 TTTTATATAGAAAGGAAACTGGG - Intronic
989446710 5:41538033-41538055 TTGTATAAAGTCATAAAACATGG + Intergenic
991955752 5:71994647-71994669 TTTTACATAGAAATGAAATATGG - Intergenic
992872221 5:81018603-81018625 TTGGATATATTGATGAAACTGGG - Intronic
993450390 5:88066751-88066773 TTGTATATAGTGAGAAAATAGGG - Intergenic
994225504 5:97247820-97247842 TTGGATAGAGAGAGGAAATAAGG + Intergenic
994250453 5:97530530-97530552 TTGTATATACATTTGAAAGACGG - Intergenic
995380551 5:111527737-111527759 TTGAATATAAACATGAAACAAGG + Intergenic
995530409 5:113086508-113086530 TTCTATATAAAAAAGAAACACGG + Intronic
995693980 5:114859115-114859137 TTTGATATAGAGGTGACACAAGG - Intergenic
995868620 5:116720546-116720568 TGGTATGTAGAGATGTGACATGG + Intergenic
997667063 5:135638820-135638842 GCTTATATAGAGTTGAAACATGG - Intergenic
998042573 5:138961662-138961684 TTTTGTCTAGAGATGAAAAAGGG - Intronic
998278094 5:140777637-140777659 TTGTAACGGGAGATGAAACATGG - Intergenic
998789907 5:145755078-145755100 TTGTACAAGGAGATGAAACATGG + Intronic
998835510 5:146199488-146199510 TTGTAACAGGAGATGAAACACGG + Intergenic
998928361 5:147152900-147152922 TTGTACCAGGAGATGAAACATGG + Intergenic
999384134 5:151142303-151142325 TTGTATTTTTAGCTGAAACAGGG - Intronic
999634307 5:153604194-153604216 TTGTATATAGAGACTAAAACAGG - Intronic
1000453217 5:161416498-161416520 TTATATAAAGAAATCAAACAAGG - Intronic
1001391862 5:171386141-171386163 TTGTATATTTAGTAGAAACAGGG - Intergenic
1001437037 5:171707514-171707536 TTGTATATAGAAAATACACAAGG - Intergenic
1001968600 5:175935074-175935096 TTGCATATAGGGATCAAACCAGG - Intronic
1002019143 5:176351038-176351060 TTGTATTTAGAAATGCAACATGG + Intronic
1002248842 5:177908682-177908704 TTGCATATAGGGATCAAACTGGG + Intergenic
1002595699 5:180321189-180321211 TTGTATAAAAAGTAGAAACATGG + Intronic
1004465140 6:15878266-15878288 TTGAAAATAAACATGAAACAAGG - Intergenic
1005676535 6:28161234-28161256 TTGGATATAAAGATGATAAAAGG - Intergenic
1005708406 6:28480178-28480200 GTGTAAATAGAGGTGAGACAAGG - Intergenic
1005807182 6:29485816-29485838 TTTTAACTAGAGATAAAACATGG + Intergenic
1006247452 6:32751282-32751304 ATGTATCTTGAGATGAAATAAGG + Intergenic
1006813964 6:36838743-36838765 TTGTTGATAGAGATGAAGGAAGG + Intronic
1009380036 6:63016367-63016389 TTGTATATTTAGTAGAAACAGGG - Intergenic
1009912206 6:69944184-69944206 TTTTATATAGAGATGCCAGAAGG - Intronic
1010007944 6:71015984-71016006 ATGATTAGAGAGATGAAACAAGG + Intergenic
1010029344 6:71256990-71257012 ATGTCTATAAAAATGAAACATGG - Intergenic
1011071268 6:83387087-83387109 TTGTTTATGGAAAAGAAACATGG - Intronic
1011462254 6:87616968-87616990 TTGTATATTTAGTAGAAACAGGG + Intronic
1011533235 6:88347797-88347819 TTGTAACAGGAGATGAAACATGG - Intergenic
1011829344 6:91352248-91352270 TTGGAGATAGAGGAGAAACAAGG + Intergenic
1011930760 6:92709232-92709254 TTGTAACAGGAGATGAAACATGG + Intergenic
1012188736 6:96254584-96254606 TTGTAACAAGAGATAAAACATGG + Intergenic
1012257771 6:97053424-97053446 TTATATTTAGTGCTGAAACAAGG - Intronic
1012260304 6:97080895-97080917 TAGGATATTCAGATGAAACAAGG + Intronic
1012272587 6:97232878-97232900 TTGTATATAGAAAGGAAATTTGG - Intronic
1012883031 6:104814587-104814609 TAGAATATGGAGATCAAACATGG + Intronic
1013468718 6:110441413-110441435 TTGTAACAGGAGATGAAACACGG + Intronic
1013905063 6:115206611-115206633 TTGTACTTAGGGATGAAATAGGG + Intergenic
1016066447 6:139688091-139688113 TTGGATACAGACATGAAACCCGG + Intergenic
1016218510 6:141634513-141634535 TTGTAAAAGGAGATGAAACGTGG - Intergenic
1016330705 6:142949146-142949168 TGGTATATAGACATAAAATATGG - Intergenic
1016403598 6:143706578-143706600 ATGTATATTGGGATCAAACAAGG - Intronic
1017643740 6:156518860-156518882 TTGTATAGTGATAGGAAACAAGG - Intergenic
1019796422 7:3052802-3052824 TTGTAGCAAGAGATGAAACATGG - Intergenic
1020357293 7:7291594-7291616 TTGCATTTAGAGATGATATATGG - Intergenic
1020663981 7:11016358-11016380 TTGTATATAAAGAATAAAAAAGG + Intronic
1020960474 7:14796503-14796525 TTGTAATCAGAGATGAAACATGG + Intronic
1021346035 7:19529547-19529569 TTATATATTGACATGAAAAAAGG + Intergenic
1021987310 7:26109356-26109378 TTGTAATAGGAGATGAAACATGG + Intergenic
1022611625 7:31880746-31880768 CTGTGTATATTGATGAAACAAGG - Exonic
1025261613 7:57424077-57424099 ATGTATATAAAAATGAATCATGG + Intergenic
1025814135 7:64894175-64894197 TTGTATTTTTAGAAGAAACAGGG + Intronic
1026180757 7:68038038-68038060 TTGTAATAAGAGATGAAACACGG - Intergenic
1026658078 7:72274903-72274925 TTGTGTAAAGAGAAGAAATAGGG + Intronic
1026860332 7:73782758-73782780 TTATCAATAGAAATGAAACATGG - Intergenic
1027745875 7:82073252-82073274 TTCTAAATAAAAATGAAACAAGG - Intronic
1027787100 7:82593892-82593914 TTATATATAGTGATGATTCATGG + Intergenic
1027877331 7:83787494-83787516 TTGTATTTTTAGAAGAAACAGGG - Intergenic
1027955424 7:84873136-84873158 TGGCATATATAGATGAGACAAGG + Intergenic
1028367579 7:90052023-90052045 GTTTATATAGTGATGAAAGAGGG - Intergenic
1030065240 7:105654368-105654390 TTGGGGATAGAGATTAAACACGG - Intronic
1030299702 7:107962808-107962830 TTATATATAGTTATGAAATATGG - Intronic
1031340830 7:120598367-120598389 TTTTATATAGGGAAGAAACATGG + Intronic
1031353699 7:120765147-120765169 TTGTGTATAGAGAGGAAGAAGGG - Intergenic
1031549299 7:123088751-123088773 ATGTGTATAGAAATGAAATATGG + Intergenic
1031644448 7:124206561-124206583 ATGTATACAGAGAAGGAACAAGG - Intergenic
1032684168 7:134213864-134213886 TTGTAAATATAGATGGAAAATGG - Intronic
1033933562 7:146554578-146554600 TTGTACATGGAGATGAAGGATGG + Intronic
1034030232 7:147754029-147754051 TTGTATTTAGAGCTGAAACGAGG - Intronic
1034756134 7:153621956-153621978 TTATGTATAGAGATGTACCAAGG - Intergenic
1037070581 8:14642377-14642399 TTGTCTATAGATATTAAAAATGG - Intronic
1037085801 8:14848191-14848213 TTGTTTAGAGAAATGAAAGAGGG + Intronic
1038206487 8:25471534-25471556 TTGTATTTTCAGTTGAAACAGGG + Intronic
1039603356 8:38860703-38860725 ATGTATACATAGATGAAAAATGG + Intergenic
1041240093 8:55841946-55841968 TTGTATTTTTAGAAGAAACAGGG - Intergenic
1041577481 8:59416022-59416044 TTGAATATATAAATGAAGCAGGG - Intergenic
1042062641 8:64837543-64837565 TTGTATATAGAGATAGGAAAAGG + Intergenic
1043115113 8:76241265-76241287 TTGTAACCACAGATGAAACATGG - Intergenic
1043229242 8:77779231-77779253 TTACATACAGAAATGAAACAAGG - Intergenic
1043579697 8:81697999-81698021 TTGTAACAGGAGATGAAACATGG + Intergenic
1043860869 8:85315499-85315521 TTGTATTTTTAGTTGAAACAGGG - Intergenic
1043930786 8:86089233-86089255 TTGTAATAAGAGATGAAATAAGG + Intronic
1043953322 8:86334075-86334097 TTGTAACAGGAGATGAAACATGG - Intergenic
1044057868 8:87594865-87594887 TTGTAACAGGAGATGAAACACGG - Intronic
1044434822 8:92149845-92149867 TTGTGTATAGAGAAAAAACAAGG + Intergenic
1044826225 8:96200090-96200112 TTGTAACAGGAGATGAAACATGG + Intergenic
1045237609 8:100368221-100368243 TTGTAGCAAGAGATGGAACATGG + Intronic
1045697487 8:104826281-104826303 TTGTAAGAAGAGATGAAATATGG - Intronic
1045980091 8:108174945-108174967 TTGTATTTATAGTAGAAACAGGG - Intergenic
1046755831 8:117971976-117971998 TTGTATTTTTAGAAGAAACAGGG - Intronic
1047074828 8:121389425-121389447 TTGTACATAGAGAAACAACATGG - Intergenic
1050433590 9:5586502-5586524 TTGTATCTAAGGATGGAACAAGG + Intergenic
1050673283 9:8022766-8022788 TTGTAACAGGAGATGAAACATGG + Intergenic
1050982090 9:12032862-12032884 CTATATATAGAGAAGATACACGG - Intergenic
1051125564 9:13800630-13800652 TTGTATAAATAGATCAAAAAAGG + Intergenic
1052105770 9:24512895-24512917 TTCTATATTGAGATGTAACTTGG + Intergenic
1053010172 9:34628392-34628414 GTGAAAATAGAGATGGAACAGGG + Intergenic
1053237309 9:36467679-36467701 TTGTGTATAGAGATGATGCATGG - Intronic
1053250165 9:36567582-36567604 TTGAGTATAGAGATGATGCATGG + Intergenic
1053437213 9:38083919-38083941 TTGTACATAAAGATAAAACCGGG - Intergenic
1054866692 9:70010006-70010028 TTGTAACAGGAGATGAAACATGG + Intergenic
1055166239 9:73198435-73198457 TTGAAAATAGTGATGAAAGAAGG - Intergenic
1055274256 9:74596412-74596434 TTGTATTTAGAGATTGCACAAGG - Intronic
1055806581 9:80101984-80102006 TTGGATATAGAAATGTAAAATGG - Intergenic
1055880263 9:80992804-80992826 TTGAATATATAGATGAAGCTGGG + Intergenic
1056084858 9:83137161-83137183 GTGTTTAAAGAGATGAAAGAAGG - Intergenic
1058565165 9:106275841-106275863 TTGTAACAGGAGATGAAACATGG + Intergenic
1059702223 9:116786179-116786201 TTGTATAAAGATCTGAAACAAGG - Intronic
1059936459 9:119316258-119316280 TTGTATATTTAGTAGAAACAGGG + Intronic
1060144932 9:121243748-121243770 TTGTATTTTTAGAAGAAACAGGG + Intronic
1060532787 9:124357986-124358008 TTGTATATAGAGCTTGAACTTGG - Intronic
1060639139 9:125224019-125224041 TTGTATTTTCAGTTGAAACAGGG - Intronic
1061374038 9:130213749-130213771 TTGTATATATAGTAGAGACAGGG + Intronic
1203736957 Un_GL000216v2:145731-145753 CTGTAGATAGAGCTTAAACAAGG + Intergenic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1186476766 X:9863490-9863512 TTTTAGGGAGAGATGAAACAAGG + Intronic
1188266029 X:28075891-28075913 TTGTAACAGGAGATGAAACATGG + Intergenic
1188508592 X:30909924-30909946 CTATTTTTAGAGATGAAACAAGG - Intronic
1188734209 X:33692551-33692573 TTGTAACAAGAGATAAAACATGG + Intergenic
1189522268 X:41782396-41782418 CTGTATATCGAGATGAGACCTGG - Intronic
1189637021 X:43022279-43022301 TTGTAACAGGAGATGAAACATGG - Intergenic
1189660340 X:43290288-43290310 TTGTAACAGGAGATGAAACATGG - Intergenic
1189684215 X:43546945-43546967 TTGTAACAGGAGATGAAACATGG - Intergenic
1190477039 X:50838887-50838909 CTGTACATAGAGAGGAAATATGG - Intergenic
1192762954 X:74114470-74114492 TTGTATATATAGCCAAAACATGG - Intergenic
1193505002 X:82331020-82331042 TTTAATATAGAGAGGAAACAGGG - Intergenic
1193940150 X:87672749-87672771 TTAGATATTTAGATGAAACATGG - Intergenic
1194037295 X:88891893-88891915 TTGTAACAGGAGATGAAACATGG + Intergenic
1194523808 X:94951035-94951057 TTGGCTATAGAGATGGAAAAAGG + Intergenic
1194560082 X:95409640-95409662 ATGTAAAGAGAGATGAAGCATGG - Intergenic
1194931686 X:99896220-99896242 TTATAACAAGAGATGAAACATGG - Intergenic
1195255911 X:103090761-103090783 TAATTTACAGAGATGAAACATGG + Intronic
1195897565 X:109762577-109762599 TTGTAACAGGAGATGAAACATGG - Intergenic
1196218465 X:113083546-113083568 TTGTAACAGGAGATGAAACAGGG + Intergenic
1196672091 X:118379121-118379143 TTATATATAGTGATGGTACATGG - Intronic
1196776920 X:119346891-119346913 TAGTATATAAAGAAGAAACAGGG + Intergenic
1197173610 X:123461715-123461737 TTGAAGAGAGAGATGAAGCAGGG + Intronic
1197972361 X:132128670-132128692 ATCTATAAAGAAATGAAACAAGG + Intergenic
1198500564 X:137241621-137241643 TTGTAACAGGAGATGAAACATGG - Intergenic
1199255533 X:145714959-145714981 GTGTATATAGAAATGAATAAGGG - Intergenic
1199354953 X:146851234-146851256 TGGTACAGAGAGATGAAAAATGG - Intergenic
1199406914 X:147472876-147472898 TTGTATATAGAGATGAACCTAGG - Intergenic
1201440530 Y:14003512-14003534 TTGTATATTTAGTAGAAACAGGG + Intergenic
1201444041 Y:14039196-14039218 TTGTATATTTAGTAGAAACAGGG - Intergenic