ID: 908379695

View in Genome Browser
Species Human (GRCh38)
Location 1:63584793-63584815
Sequence ATAAGGCTTCTGGTCAACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 3, 2: 19, 3: 46, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908379691_908379695 10 Left 908379691 1:63584760-63584782 CCTTTCTCTAGCTAACTTTATTG 0: 1
1: 9
2: 33
3: 48
4: 202
Right 908379695 1:63584793-63584815 ATAAGGCTTCTGGTCAACATAGG 0: 1
1: 3
2: 19
3: 46
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908379695 Original CRISPR ATAAGGCTTCTGGTCAACAT AGG Intronic
900315753 1:2055574-2055596 CTGAGGATTCTGGCCAACATGGG - Intronic
902233906 1:15045519-15045541 GTAAGGCTTCTGGTTAACAGTGG - Intronic
902553132 1:17230941-17230963 ATAAGGCGGCTGGTCACCAAGGG + Intronic
906254335 1:44336156-44336178 TTAGGTCTTCTGGTCAACAAGGG - Intronic
907692165 1:56680048-56680070 GTAAGGCTTCTGCTCAACAGTGG + Intronic
908379695 1:63584793-63584815 ATAAGGCTTCTGGTCAACATAGG + Intronic
908514055 1:64874448-64874470 GTAAGGCTTCCAGTCAACAGTGG + Intronic
908579608 1:65500708-65500730 GTAAGGCTTTTGGTTAACAGTGG + Intronic
908689294 1:66759446-66759468 CTAGGGCTTCTGCTCAACAAAGG + Intronic
917736717 1:177927812-177927834 ATAAGGCTTCCAGTCAACAGTGG - Intronic
918999890 1:191816941-191816963 GTAAGTCTTCTGGTCAAGAGTGG + Intergenic
919010464 1:191954749-191954771 ATAAGGCCTCTGGTCAACTCAGG + Intergenic
920563944 1:206959072-206959094 ATGAGGCTTATGGTTAACATAGG + Intronic
922170599 1:223151227-223151249 ATGAGGCTTCTGATCATGATGGG - Intergenic
923815237 1:237370315-237370337 GTAAGGCTTCTGGTCAACAGGGG - Intronic
1065421747 10:25552403-25552425 AGAAGGCTTATTGTCCACATGGG - Intronic
1067317872 10:45186145-45186167 GTAAGGCTCCAGGTCAACAGTGG + Intergenic
1068984600 10:63095577-63095599 GTAAGCCTTCTGGTTAACAATGG + Intergenic
1071521437 10:86333624-86333646 GTAAGGCTTCCGGTCAACAGTGG - Intronic
1071701854 10:87947211-87947233 GTAGGGCTTCTGGTCAACAGTGG - Intronic
1074910213 10:117901550-117901572 TTAAGGCTTTTGGGCAACAGTGG - Intergenic
1075692561 10:124408380-124408402 ACCAGCCTTCTGGGCAACATAGG - Intronic
1076196241 10:128520322-128520344 ACAAGTCTACGGGTCAACATGGG + Intergenic
1076433654 10:130424846-130424868 ATAAGGCCTCTACTCAAGATAGG + Intergenic
1078007212 11:7540938-7540960 ATAAGGCATCTGGTGAGGATGGG + Intronic
1078571504 11:12461966-12461988 ATGTGGCTTCAGGTAAACATGGG - Intronic
1080232422 11:30032834-30032856 GTAAGGCTTCTGGTCAACAGTGG + Intergenic
1081363002 11:42203053-42203075 TATAGGCTTCTGGTCAACAGGGG + Intergenic
1083580218 11:63819856-63819878 ATCAGGCTTCTGGGAAACACTGG - Intronic
1084772924 11:71356118-71356140 GTAAGGCTTCTGGTCAACAGTGG + Intergenic
1086018865 11:82201128-82201150 GTAAGGCTTCGGGGGAACATGGG - Intergenic
1094274154 12:28651263-28651285 AAAAAGCTTCTGCTCAACAAAGG - Intergenic
1096014632 12:48258440-48258462 ATAAGGCTGCTGTTGAACATGGG - Intergenic
1097730942 12:63127358-63127380 GTAAGGCTTCCTGTCAACAGTGG + Intergenic
1099192945 12:79579224-79579246 ATAAAGCTTCTGCACAACAAAGG + Intronic
1099270162 12:80498691-80498713 ATTAGGCTTCTGCTCAGCATGGG + Intronic
1099826950 12:87788608-87788630 AAAAAGCTTCTGGACAACAAAGG - Intergenic
1099989286 12:89707332-89707354 ATAAGGCTTTTGTTCAGCGTGGG - Intronic
1101444972 12:104731150-104731172 ATGAGGGTTCTGGTCAATTTGGG - Intronic
1101746059 12:107542681-107542703 GTAAGGCTTCTGGTCAACAGTGG - Intronic
1103022653 12:117548544-117548566 GTAAGGCTTCTGATCAACAGTGG + Intronic
1103916121 12:124376543-124376565 GCCAGGCTTCTGGTCAACTTGGG + Intronic
1105227448 13:18449453-18449475 ATAAAGCTTCTGGTAAGCCTTGG + Intergenic
1105612312 13:21979117-21979139 GTAAGGCTTCCAGTCAACAGTGG - Intergenic
1105653633 13:22408743-22408765 ATAAGGTTTCTGCTAAAGATAGG - Intergenic
1107053744 13:36080403-36080425 ATAAAGCTTCTGGTCCATGTCGG + Intronic
1108868546 13:54952536-54952558 GTAAGGCTTCTGGTCAACATAGG + Intergenic
1109287382 13:60425945-60425967 GTAAGGCTTCTGGTCAGCAGTGG + Intronic
1110645825 13:77882712-77882734 GTAAGGCTTCTAATCAACAGTGG - Intergenic
1111633129 13:90868684-90868706 GTAAATCTTCTGGTCAACAGTGG - Intergenic
1113235928 13:108274146-108274168 GAAAGGCTTCTGGTCAACAGTGG + Intronic
1113401342 13:109996592-109996614 ATTAGCTTTGTGGTCAACATCGG - Intergenic
1114011901 14:18377908-18377930 ATAAAGCTTCTGGTAAGCCTTGG + Intergenic
1117275833 14:54192471-54192493 ATAAGCCCTCTCCTCAACATAGG - Intergenic
1118013978 14:61640032-61640054 GTAAGGCTTCCGGTCAACAGTGG + Intronic
1118773707 14:68959899-68959921 GTAAGGCTTATAGTCAACACTGG - Intronic
1120610620 14:86636901-86636923 ATAAGGCTTCTGTTCATGCTGGG + Intergenic
1121877477 14:97466737-97466759 GTAAGGCTTCTGGTCAATAGGGG + Intergenic
1122200554 14:100120086-100120108 CTAAGGCCTCTGGTCAGCAGAGG + Intronic
1124013940 15:25861051-25861073 CTCAGGCTTCTGGTGAACAGGGG + Intronic
1126139487 15:45425638-45425660 GTAAGGCTTCTGGTCAACACTGG + Intergenic
1126342282 15:47654329-47654351 CTAAGGCTTCTGGTCACAATAGG - Intronic
1126518695 15:49564004-49564026 AAAAAGCTTCTGCACAACATAGG + Intronic
1129625996 15:77200336-77200358 ATAAGGCTTATGGTCAACAGTGG + Intronic
1130775923 15:86982800-86982822 GTAAGGCTTCTGGTCAAAGTAGG + Intronic
1132860416 16:2068474-2068496 GCAAGGCTTCTAGTCAACAGAGG - Intronic
1133922593 16:10167009-10167031 GTAAGGCTTCTGATCAACAGTGG + Intronic
1134323153 16:13182031-13182053 ATGTAGCTTCTGGTCACCATTGG - Intronic
1134343029 16:13362662-13362684 ATAAGGCTTAGGGACAAGATGGG - Intergenic
1137838186 16:51614698-51614720 ATAATGCTCCTGGCCAACATAGG - Intergenic
1138201764 16:55093899-55093921 GTAAGGCTTCTGGTCAACAGTGG + Intergenic
1140046493 16:71443191-71443213 CTCAGGCTCCTGGTCAGCATAGG - Intergenic
1141059102 16:80848364-80848386 ACAAGGCTTTAGGACAACATAGG + Intergenic
1141737840 16:85866866-85866888 GTAAGGCTTCTGGTCAACAGTGG + Intergenic
1143350090 17:6281602-6281624 TTAAAGCTTCTGGTCAGAATTGG + Intergenic
1146632567 17:34481444-34481466 ATCAGGCTTCTGGGAACCATAGG - Intergenic
1152447043 17:80351397-80351419 ATAGGGTTTCTGGTCAACGAAGG + Intronic
1152738658 17:82009442-82009464 ACAGGGCTTCTGGTCAGAATGGG - Intronic
1153285984 18:3454242-3454264 ATCAGGCTTCTTGTCAAACTAGG + Intronic
1153752267 18:8244965-8244987 ACCAGGATTCTGGTCAGCATGGG + Intronic
1153781464 18:8498749-8498771 GCAAGGCTTCTGGTCAACACAGG - Intergenic
1154476271 18:14761949-14761971 ATAAGGCTCCAGGTCAACAGTGG - Intronic
1154525928 18:15290023-15290045 ATAAAGCTTCTGGTAAGCCTTGG - Intergenic
1155861347 18:30904531-30904553 ATAAGGCTTCTGGTGAAAGATGG + Intergenic
1158091382 18:53717862-53717884 GTAAGGCTTTTGGTCAACAGTGG + Intergenic
1158381715 18:56937840-56937862 GTAAGACTTTTGGTCAACAGTGG - Intronic
1158500831 18:57999907-57999929 ATAAAGCTTCTGTGCAACAAAGG - Intergenic
1158733835 18:60057042-60057064 GTAAGGCTTCCTGTCAACTTAGG - Intergenic
1159257121 18:65961219-65961241 GTAAGGCTTATGATCAACAGTGG - Intergenic
1161802825 19:6425329-6425351 AAAAGGATTCTGGTTAACAAGGG - Intergenic
1162179903 19:8861255-8861277 AGAAGGGTTCTGATCAAAATGGG + Intronic
1167978493 19:53252932-53252954 AGTAGACTTCTGGTCAACAATGG - Intronic
925439413 2:3871527-3871549 GTAAGGCTTCTGGTCAACAGTGG + Intergenic
925634291 2:5927656-5927678 GTAAGGCTTCTGGTCAAAATAGG + Intergenic
926158960 2:10474791-10474813 CTTTGGCTTCTGGTCAACACTGG - Intergenic
926442129 2:12900945-12900967 GTCAGGCTTCCAGTCAACATAGG + Intergenic
927993088 2:27461927-27461949 AAAAGGCTTTTGGTCCTCATGGG - Intronic
928978181 2:37110853-37110875 ATAATGCTGCTGATGAACATGGG - Intronic
929624225 2:43389781-43389803 AGAAGGCTTCAGGGGAACATTGG - Intronic
930401459 2:50895126-50895148 CTAAGGCTTCTGTTAAACTTGGG - Intronic
930585364 2:53261428-53261450 AGAAGGCTTTTGGTCAAGAAAGG - Intergenic
931074622 2:58695935-58695957 AAAGGGATTCTGTTCAACATGGG - Intergenic
934938763 2:98484280-98484302 ATAAGGCTTGTGGGCAACTAGGG - Intronic
936770780 2:115910576-115910598 ATAAGTCTTCTAGGGAACATGGG - Intergenic
937617130 2:123938626-123938648 GTAAAGCTTCTGGTCAACACTGG + Intergenic
938525032 2:132121388-132121410 ATAAAGCTTCTGGTAAGCCTTGG - Intergenic
939081555 2:137668682-137668704 GTAAGGCTTCTGATCAAAAGCGG - Intronic
940226267 2:151404370-151404392 ATAAAGCTTCTGCTCAGCAAAGG - Intergenic
941963735 2:171279991-171280013 GTGAGGCTTCTGGTCAATAGAGG + Intergenic
942085552 2:172440047-172440069 AGAATTCTTCAGGTCAACATTGG + Intronic
943378134 2:187106830-187106852 ATAAGACTTCTGGTTAACAGTGG - Intergenic
945146142 2:206740229-206740251 GCAAGACTTCTGGTCAACAGTGG - Intronic
946199161 2:218061282-218061304 CTAGGGATTCTGGCCAACATGGG + Intronic
948524940 2:238565709-238565731 ATAAGTCTTCTTGCCAACAAGGG - Intergenic
948841495 2:240652225-240652247 GTAAGGCTTCGGGTCAACAGCGG - Intergenic
1173139445 20:40469573-40469595 AGAAGGTGTCTGGTCAACCTAGG - Intergenic
1173228067 20:41173613-41173635 AAAAGGCTTCAGGTCACCGTGGG - Intronic
1176616540 21:9031334-9031356 ATCAGGCTGCAGGTGAACATCGG + Intergenic
1176771494 21:13078465-13078487 ATAAAGCTTCTGGTAAGCCTTGG + Intergenic
1176994302 21:15536806-15536828 TTAAGGCTGCTCTTCAACATGGG - Intergenic
1178346667 21:31834539-31834561 GTAAGGCTTTCAGTCAACATAGG + Intergenic
1179155301 21:38845168-38845190 ATAAGGCCTATGGTCCACCTTGG + Intergenic
1179235602 21:39542748-39542770 ATAAGGCTTCTGTTCCAGAGAGG - Intergenic
1180436393 22:15308716-15308738 ATAAAGCTTCTGGTAAGCCTTGG + Intergenic
1182704346 22:32266717-32266739 GTAAGGCTTCCAGTCAACAATGG - Intergenic
1182755521 22:32675873-32675895 ATTAGGTTTCTGGCCATCATGGG - Intronic
949394367 3:3598904-3598926 GAAAGGCCTCTGGTCAACACTGG - Intergenic
949793295 3:7817356-7817378 ATAAGGCTTATTCTCAAAATAGG - Intergenic
951131418 3:19049781-19049803 ATAAGGCTTCTGGTCAACAGTGG + Intergenic
953059284 3:39413915-39413937 AGAAGGCTACTGGTCAACAGGGG + Intergenic
953361174 3:42298138-42298160 ATAAGGATTCCAGTCAACATTGG - Intergenic
955109593 3:55935148-55935170 ATAAGGCTGCTGATCAAAATAGG + Intronic
956763762 3:72466466-72466488 ATCAGCCTTCTGCCCAACATTGG - Intergenic
957530166 3:81430747-81430769 ATACTGCCTGTGGTCAACATAGG + Intergenic
960015889 3:112887282-112887304 GTAAGGCTTCTGGTTAATAGTGG - Intergenic
960815917 3:121672605-121672627 AAAAGGCTTCTGTTCAGCAAAGG - Intronic
969789784 4:9484889-9484911 ATAAGGTTTCTGCTAAACAAAGG - Intergenic
972387114 4:38577871-38577893 ATAAGGCTTATGAAAAACATGGG + Intergenic
972696695 4:41453354-41453376 GTAAGGCTTCTGGTCAATAGTGG - Intronic
972753194 4:42013908-42013930 AAAAGGCTTCTGCACAACAAAGG + Intronic
975530608 4:75395861-75395883 CTAGGGCTTCTGGGCAACTTAGG - Intergenic
976138691 4:81966555-81966577 AGAAAGCTTCTGGTGAACCTAGG - Intronic
980397655 4:132235632-132235654 AAAATGCTTCTGCTCAACAAAGG + Intergenic
980533253 4:134081871-134081893 ATAATGCTTCTATTCATCATCGG + Intergenic
983978197 4:173962904-173962926 GTAAGGCTTCTGGTCAACAGTGG + Intergenic
985168331 4:187121592-187121614 ATAAGGCTTCCAGTCAACAGTGG - Intergenic
985168487 4:187123441-187123463 ATAAGGCTTCCAGTCAACAGTGG + Intergenic
985937043 5:3105584-3105606 ATAAGGCACCTGGTGTACATAGG + Intergenic
986279299 5:6310556-6310578 GTAAGGTTCCTGGTCAACAGAGG + Intergenic
986342600 5:6803871-6803893 TTAAGGTTTCAGGTCCACATAGG + Intergenic
986472721 5:8091994-8092016 CTAAGGATTTTGGTCTACATGGG + Intergenic
987557713 5:19476449-19476471 AAAAGGCTTTTGCTGAACATAGG + Intronic
987963858 5:24847093-24847115 TTAAGACTTCTGGTCAACAGTGG - Intergenic
988252189 5:28773624-28773646 TAAAGGTCTCTGGTCAACATAGG - Intergenic
989363249 5:40627113-40627135 TTCAGGCTTCTGGTCACCTTGGG - Intergenic
989364625 5:40642010-40642032 GTAAGGCTTCCGGTCAGCAATGG + Intergenic
989372129 5:40721815-40721837 AAAAGGCTTCTGCACAACAAAGG + Intronic
989483715 5:41963509-41963531 GTAAGACTTCTGGTCAAAGTAGG - Intergenic
992079767 5:73224726-73224748 ATCAGCTTTCTGGTCAACAATGG + Intergenic
992140180 5:73788443-73788465 ACAAGGCTTCTGGTCATCAGTGG - Intronic
994222372 5:97210589-97210611 ACAAGTCTTCTGGTCTACTTAGG + Intergenic
994570631 5:101508755-101508777 CTAAGGCTTCCTGTCAAGATTGG + Intergenic
995195244 5:109359280-109359302 ACAAGGCTTCTGGTCAACAGTGG + Intronic
996040438 5:118803875-118803897 AAAAGGCTTCTGCACAACAAAGG + Intergenic
998088083 5:139342735-139342757 ATAAGGCTTGTGGTGAACTTAGG + Exonic
1001925374 5:175632359-175632381 GTAAGGCTTCTAGTCAACAGTGG - Intergenic
1002876895 6:1218665-1218687 GTAAGGCTTCTGGTCAACAGTGG - Intergenic
1004065855 6:12243069-12243091 CTAAGGTTTCTGGTCAACAGCGG - Intergenic
1008742301 6:54624425-54624447 ATAAGTCTTTTTGTGAACATAGG - Intergenic
1009439304 6:63657397-63657419 GTAAGGCTTCCAGTCAACATAGG - Intronic
1009449978 6:63789436-63789458 ATGAGGGTTCTGGTCAACCTGGG + Intronic
1010358755 6:74967321-74967343 GTAAAGCTTCTGGTCAATAGTGG + Intergenic
1011226360 6:85111771-85111793 AGAAGGCTTTTGGACAAAATAGG - Intergenic
1013940456 6:115654956-115654978 GTAAGGCTTCTGGTCAACAGTGG + Intergenic
1014303237 6:119709973-119709995 ATAAGGCTTCTGGTCAGGTTAGG + Intergenic
1015699455 6:136019678-136019700 GTAAGGCTTCTGGTCAAAATAGG - Intronic
1016640408 6:146341795-146341817 ATAAGGCTTCTCGTTAAGACTGG - Intronic
1018217384 6:161542253-161542275 ACAAGGCTTCCCGTCAACAGTGG + Intronic
1019488763 7:1301390-1301412 ATAAGGTTTCTGGACAACTGGGG + Intergenic
1021212667 7:17874374-17874396 ATAAGGGTTATGGTTAACAGTGG + Intronic
1021849770 7:24796084-24796106 GGAAGGCTTCTGGTCAACAGTGG + Intergenic
1023228997 7:38004767-38004789 ATAAAGTTTCTGGAAAACATTGG + Intronic
1024572946 7:50739704-50739726 TTTGGGCTTGTGGTCAACATCGG + Intronic
1028393480 7:90341273-90341295 ATAAGGTTTCTGATGAACAAAGG - Intronic
1028997054 7:97112576-97112598 ATAAGGCTTCTGATCAATAGTGG + Intergenic
1030167383 7:106569003-106569025 ATTAGGCTGCTGCTGAACATGGG - Intergenic
1030308750 7:108047561-108047583 GTAAGGCTTCCAGTCAACAGTGG + Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1035924215 8:3710027-3710049 GTAAGGCATCTGGTCAAGAGTGG - Intronic
1036419699 8:8584183-8584205 GTAAGGCTTCTAGTCAACAGTGG - Intergenic
1036902778 8:12683956-12683978 ATGAGGTTTCTGCTCAACAAAGG + Intergenic
1036905203 8:12702868-12702890 ATGAGGTTTCTGCTCAACAAAGG + Intergenic
1037366412 8:18127093-18127115 GTAAGGCTTATGGTTAACAGTGG + Intergenic
1046842501 8:118875506-118875528 ATAAGGCTTTCAGTCAACAGTGG + Intergenic
1047120330 8:121896285-121896307 ATAAGGTTTCTCGTAAGCATAGG + Intergenic
1047868030 8:129050531-129050553 GTAAGGCTTCTGGTCAACATAGG + Intergenic
1050319615 9:4437950-4437972 ACAAGGCTTCTGTTCAACAGTGG + Intergenic
1051155115 9:14134277-14134299 CTAAGGCTTTTGGTAAATATTGG - Intronic
1052994496 9:34543857-34543879 ATAAGGCTTCTCGTCAACAGTGG - Intergenic
1053100818 9:35370954-35370976 ATGGGGCTTCTGGTCATCCTGGG - Intronic
1057952298 9:99379238-99379260 GTAAGGCTTCCAGTCAACAGTGG + Intergenic
1058718892 9:107745840-107745862 GTAAGGCTTCTGGTCAACAGTGG + Intergenic
1059875927 9:118634618-118634640 ATGAGACTTCTGGTCAAGAGTGG - Intergenic
1060128038 9:121069164-121069186 AAAAGGCTTCTGCACAACAAAGG + Intergenic
1061538537 9:131264698-131264720 AAAAGGCTTCAGGTCAAATTAGG - Intronic
1186168748 X:6855330-6855352 GTAAGGCTTCTGGTCAGCAGTGG + Intergenic
1189183252 X:39024808-39024830 AAAAGGCTTCTGAACAACAAAGG - Intergenic
1190484168 X:50908181-50908203 ATAAGACTTCTAGCCAACAGCGG + Intergenic
1191730239 X:64325981-64326003 ATCAGGCTTCTGGTCAACAGTGG - Intronic
1193132073 X:77930858-77930880 AAAAGGCTGCTGGTCACCATTGG - Intronic
1193291663 X:79780305-79780327 GTAAGCCTTCTGGTCAATAGTGG + Intergenic
1193431228 X:81408400-81408422 AAATGGCTTCTGGTCTACAAGGG - Intergenic
1193632218 X:83904025-83904047 AAAAGGCTTCTGCACAACAAAGG + Intergenic
1196215210 X:113042688-113042710 AAAAGGCTTCTGCTCAGCAAAGG - Intergenic
1196230851 X:113219342-113219364 GGAAGGCTTCTGGTCAACAGTGG + Intergenic
1197537161 X:127704955-127704977 GTAAGGCTTCTGGTCAACAGTGG - Intergenic
1199606592 X:149584019-149584041 ATAGGGCCTCAGGTCAACAGAGG - Intronic
1199632531 X:149785349-149785371 ATAGGGCCTCAGGTCAACAGAGG + Intronic
1199683865 X:150247342-150247364 GAAAGGCTTCTGGTCAGCAAAGG + Intergenic
1200298424 X:154946739-154946761 ATAAAGCTTCTGGACAGCAAAGG + Intronic