ID: 908380456

View in Genome Browser
Species Human (GRCh38)
Location 1:63593242-63593264
Sequence CTCTAGGCCTCCTGTGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908380456_908380475 27 Left 908380456 1:63593242-63593264 CCCATTTCACAGGAGGCCTAGAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 908380475 1:63593292-63593314 GGACCTGCCAGGAGGTGGGCTGG 0: 1
1: 0
2: 8
3: 65
4: 551
908380456_908380461 6 Left 908380456 1:63593242-63593264 CCCATTTCACAGGAGGCCTAGAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 908380461 1:63593271-63593293 GCTCCCCTTTCCCCTCCCGCCGG 0: 1
1: 0
2: 4
3: 37
4: 418
908380456_908380472 22 Left 908380456 1:63593242-63593264 CCCATTTCACAGGAGGCCTAGAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 908380472 1:63593287-63593309 CCGCCGGACCTGCCAGGAGGTGG 0: 1
1: 0
2: 0
3: 20
4: 162
908380456_908380466 16 Left 908380456 1:63593242-63593264 CCCATTTCACAGGAGGCCTAGAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 908380466 1:63593281-63593303 CCCCTCCCGCCGGACCTGCCAGG 0: 1
1: 0
2: 2
3: 25
4: 273
908380456_908380469 19 Left 908380456 1:63593242-63593264 CCCATTTCACAGGAGGCCTAGAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 908380469 1:63593284-63593306 CTCCCGCCGGACCTGCCAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 108
908380456_908380473 23 Left 908380456 1:63593242-63593264 CCCATTTCACAGGAGGCCTAGAG 0: 1
1: 0
2: 1
3: 17
4: 154
Right 908380473 1:63593288-63593310 CGCCGGACCTGCCAGGAGGTGGG 0: 1
1: 0
2: 1
3: 3
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908380456 Original CRISPR CTCTAGGCCTCCTGTGAAAT GGG (reversed) Intronic
902519951 1:17010652-17010674 CTCTGGGCCTCGTTTTAAATGGG - Intronic
903115967 1:21178184-21178206 CTCAAGCAGTCCTGTGAAATAGG + Intergenic
903745823 1:25586002-25586024 CTCTGGGCCATCTGTAAAATGGG - Intergenic
905631391 1:39520998-39521020 CTCTGGGTCTCCTGTGAAGTAGG + Intronic
905666363 1:39765173-39765195 CTCTGGGTCTCCTGTGAAGTAGG - Intronic
908380456 1:63593242-63593264 CTCTAGGCCTCCTGTGAAATGGG - Intronic
909201089 1:72691318-72691340 CTCTGTGACTCCTGTGAAAGAGG + Intergenic
912260745 1:108109773-108109795 CCCTAGGCCTTGTGGGAAATGGG + Intergenic
912946869 1:114092711-114092733 CTCTAACCCTTCTGTGAAAGGGG + Intronic
915513851 1:156401465-156401487 CTGTAGGCCTCCTCTGCAAAAGG + Intergenic
922126155 1:222726264-222726286 CTCTAGTCTTCCTCTGAAAATGG + Intronic
923872262 1:238008570-238008592 CTCTAGGTCTGCTATGAGATTGG - Intergenic
924156940 1:241187289-241187311 CCCTAGGAATCCTGTGAAGTAGG + Intronic
1065583653 10:27196431-27196453 CTCCAGTACTCCTGTGAAGTAGG + Exonic
1067238235 10:44469388-44469410 GCCTTGGCCCCCTGTGAAATGGG - Intergenic
1069185141 10:65413071-65413093 CTCCAGGCCTGCAGAGAAATGGG - Intergenic
1070239895 10:74668931-74668953 CTCTCTGCCTCCTGTGTAGTTGG - Intronic
1071710898 10:88048145-88048167 CTGAAGGCTTCCTGAGAAATAGG - Intergenic
1074898422 10:117796389-117796411 CTCCGGGCCTCCTGAGCAATGGG + Intergenic
1078411979 11:11131110-11131132 CTCTAGACATCCTCTGAAAAAGG + Intergenic
1081449694 11:43159868-43159890 GTCTACGCCCCCTGTGATATTGG - Intergenic
1081449964 11:43161451-43161473 CTATACACCTCCTGTGATATTGG - Intergenic
1082941297 11:58708075-58708097 GTCTAGAACTCCTGTGAAAGGGG - Intronic
1083162546 11:60863873-60863895 CTCTTGGCCTCCTCTGATCTGGG - Intergenic
1085336789 11:75702580-75702602 CTCTGGGCCTCCACTGAATTAGG - Intergenic
1085643382 11:78207447-78207469 CTCTGGGCTGCCTGTGACATGGG + Intronic
1086280538 11:85182214-85182236 CTCTAAGCCTCATGTTAAAATGG - Intronic
1086926795 11:92649443-92649465 CTCTAGACCTCTCCTGAAATTGG + Intronic
1087833934 11:102850934-102850956 CTGTAGGCATCCTGTGTGATTGG + Intergenic
1088024667 11:105163454-105163476 CTCCAGGCCTCCTGTGGAATAGG + Intergenic
1089042251 11:115463006-115463028 CTCATGGGCTCCTGTAAAATAGG + Intronic
1089305881 11:117525839-117525861 CTCTAGGCCTACTGGGAGATGGG + Intronic
1089473878 11:118742839-118742861 CACTAGGCCAACTGTGAGATGGG + Intergenic
1092505822 12:9098746-9098768 CTCAAATCCACCTGTGAAATTGG + Exonic
1095076661 12:37937110-37937132 ATTTAGGCCTACTGTGAAAATGG - Intergenic
1095191016 12:39258087-39258109 CTCTAGGTCTCTTGTCATATTGG - Intergenic
1097579230 12:61433227-61433249 CTCTAGGTCACCTGAAAAATGGG - Intergenic
1099181034 12:79472899-79472921 CTATACACCTCCTGTGATATTGG - Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1101310370 12:103573358-103573380 CTCAAGGCCCCCTGTGTACTAGG - Intergenic
1102561258 12:113763930-113763952 CTCTGGCCCTCCTGTGACCTTGG - Intergenic
1103137668 12:118521684-118521706 TTCTAAGCCTGTTGTGAAATTGG - Intergenic
1103225261 12:119282039-119282061 CTCTAGGATTCCTGGAAAATGGG - Intergenic
1103344122 12:120238023-120238045 CTCCGGGCCTCCGGAGAAATTGG - Intronic
1103704340 12:122863182-122863204 CTCTTGGCCTCCTGTGTAAAAGG - Intergenic
1106565288 13:30879426-30879448 CTCTTGGCGGCCTGTAAAATGGG + Intergenic
1106787778 13:33124198-33124220 CTCTCTGGCTCCTGTGAAAAAGG - Intronic
1111174970 13:84582350-84582372 CTCTTGGGCTGCTCTGAAATTGG + Intergenic
1111493202 13:89012204-89012226 CTGTTGGCATCCTGTGTAATGGG + Intergenic
1111789146 13:92830708-92830730 CACTTGGCATCCTATGAAATGGG + Intronic
1113167437 13:107458264-107458286 CTTTAGGTCTCCTGTCAAAGCGG - Intronic
1117118841 14:52547235-52547257 CTCTTGGCCACATCTGAAATTGG - Intronic
1118342802 14:64909774-64909796 CTCTACTCCATCTGTGAAATGGG + Intergenic
1119065485 14:71521501-71521523 CTCTAGCCTTCCTCTGAAGTAGG - Intronic
1122617675 14:103031338-103031360 CTCTAGGCATCTGGTGAAAAGGG - Intronic
1123130850 14:105984128-105984150 CCCAAGGCCTCCTGGGACATTGG - Intergenic
1123348487 15:19129379-19129401 CTCTAGGCCTAAGGTGAAAAGGG + Intergenic
1123349048 15:19138756-19138778 CTCTAGGCCTAAGGTGAAAAGGG + Intergenic
1124802040 15:32842369-32842391 CTTCAGGTCTCCTGTGAAGTTGG - Intronic
1124811174 15:32940190-32940212 CTCTTGGCCAGCTGTGGAATGGG + Intronic
1126767459 15:52023254-52023276 CTCTAGGTCCCCTGTTAAAATGG + Intronic
1128797731 15:70477695-70477717 CTCTGAGCCTCCTGCAAAATGGG - Intergenic
1130114810 15:80997548-80997570 CTCAAGGCCTACACTGAAATAGG - Intergenic
1133591951 16:7253676-7253698 TTCTAGGCCACCTGAGAAGTAGG - Intronic
1133679727 16:8109517-8109539 CTCTAGCCTGCCTGTAAAATCGG - Intergenic
1134608090 16:15586890-15586912 CTCTTGGGCCCCGGTGAAATGGG - Exonic
1141912735 16:87071007-87071029 TTTTTGGCCTTCTGTGAAATGGG - Intergenic
1142686754 17:1581534-1581556 CTCAAGGCCTCCTGTAAAAAGGG + Intronic
1143931878 17:10437810-10437832 CTCTAGGCCTCCTCTGATGGTGG + Intergenic
1144409496 17:14986722-14986744 CTCTAGGACTCATGTAGAATTGG - Intergenic
1145184269 17:20780633-20780655 ATCTGGGCCTGCAGTGAAATAGG - Intergenic
1145417450 17:22730959-22730981 TTCTAGGCCTACGGTGAAAAGGG + Intergenic
1145929622 17:28675675-28675697 CTCTAGGACTACTGTGGGATTGG + Intronic
1146423939 17:32717954-32717976 CTCTAGTCCTTCTGTTACATGGG + Intronic
1147432131 17:40378291-40378313 ATCTAGGCCTCCTGTGTAGCTGG - Intergenic
1148496929 17:48058599-48058621 CTCTGGGCCTGCTGTGTCATTGG - Exonic
1149420988 17:56510806-56510828 CGCTAGGCTTCCTGGGAAAGCGG + Intronic
1150999373 17:70356839-70356861 CTTGAGGCATCCTGTAAAATAGG - Intergenic
1151177929 17:72303790-72303812 CTCTTGGCTCCCAGTGAAATCGG + Intergenic
1155262149 18:24053748-24053770 CATCAGGTCTCCTGTGAAATTGG + Intronic
1161258751 19:3323895-3323917 CTCAAGGCCTCCAGGCAAATAGG - Intergenic
1162739911 19:12767939-12767961 GGCTCGGCCTCCTGGGAAATGGG + Intronic
1165445534 19:35855175-35855197 CTCTACACCCCCTGGGAAATGGG + Intronic
1165798661 19:38534447-38534469 CTCCAGGCCATCTGTGAACTTGG - Intronic
926139428 2:10359547-10359569 CTCCAGGCCACCTGGGAAGTGGG - Intronic
926370236 2:12171734-12171756 GTATCGGCCTCCTGTGGAATGGG + Intergenic
928422215 2:31146817-31146839 CTGTAGGCCTCCCTGGAAATGGG + Intronic
930169669 2:48238241-48238263 CTCTAGGCCTCCTGAGTAGCTGG + Intergenic
930197248 2:48522162-48522184 GTCTGGGCCTCTTGTGACATGGG + Intergenic
931710569 2:64986623-64986645 CTCTATGCCTCCTGCAAAAATGG - Intergenic
931791823 2:65670584-65670606 CTCTAGGGCACCTGGAAAATAGG - Intergenic
932323575 2:70839288-70839310 CTCTAGTCCTGCTGTGCACTAGG + Intergenic
933748120 2:85585313-85585335 CCCTAGGGCTCCTGGGAAAATGG + Intronic
939446356 2:142314683-142314705 CTTTAGGCCTCCTTTTAAAATGG + Intergenic
940905454 2:159165327-159165349 AGCTAGACCTCCTGTGGAATGGG + Intronic
942440199 2:176026322-176026344 CTCTATTTCTCCTTTGAAATTGG + Intergenic
945369978 2:209004499-209004521 CTCTAGGCCTCCTGTTAACATGG + Intergenic
1169716754 20:8628130-8628152 CTCTAGGCCATTTGTGGAATGGG + Intronic
1170065273 20:12303736-12303758 GTCTAGACATCCTTTGAAATAGG + Intergenic
1173121109 20:40290019-40290041 CTCTAAGCCACCTGTGACATGGG - Intergenic
1173161459 20:40655680-40655702 CTCTAGGCCATCTGTGAATAGGG - Intergenic
1175240201 20:57541878-57541900 CCCCAGGCCTTCTGTGACATTGG - Intergenic
1178583978 21:33857870-33857892 CTTAAGGACTCCTGTGGAATAGG + Intronic
1178835503 21:36094148-36094170 CTGTAAGCCTGCTGTGAAAACGG + Intergenic
1182489539 22:30661988-30662010 GTCTAGGCCTCCTGTGAGGTAGG + Intronic
1184119502 22:42440956-42440978 CTCGAGGCCTCCTGCGAACCAGG - Intergenic
949316097 3:2757287-2757309 CTGCAGGCCTTCTCTGAAATAGG + Intronic
950471375 3:13188717-13188739 CTCCAGGCCTGCGGTGAAAGAGG - Intergenic
951793966 3:26517663-26517685 CTCTGGGCCTCTGGTGAGATGGG - Intergenic
957648211 3:82963087-82963109 CTCTACTCATGCTGTGAAATAGG + Intergenic
958199673 3:90294993-90295015 TTCTAGGCCTATTGTGAAAAAGG - Intergenic
961551096 3:127671129-127671151 CCCTAGGCCTCCAGTGAGAGTGG - Intronic
962052699 3:131834872-131834894 ATCTAGGTCTCATTTGAAATTGG + Intronic
963261946 3:143201809-143201831 CTCTAGGGGTCCTGGGAAAGGGG + Intergenic
964644602 3:158945374-158945396 CTCCAGAGCCCCTGTGAAATAGG + Intergenic
964716323 3:159726316-159726338 CCCTAGACTTCCTGAGAAATTGG - Intronic
966495496 3:180575617-180575639 ATCTGGGCCTACTGTGAGATAGG + Intergenic
968056754 3:195697595-195697617 TTCTATTTCTCCTGTGAAATAGG - Intergenic
968735833 4:2296144-2296166 CTCTAGGCCAGCTGTGAATTGGG + Intronic
972802098 4:42487389-42487411 CGGTAGGGCTCTTGTGAAATAGG - Intronic
975973612 4:80072132-80072154 CTTTTGGCCTCTTGGGAAATGGG - Intronic
977388157 4:96371508-96371530 CTCAAGGCCTCCTGAGAAGCTGG + Intergenic
981520610 4:145657995-145658017 ATCTAGACCTCGTGTGAACTCGG - Exonic
982606955 4:157527558-157527580 CTCTAGGCCCCCTGTAAACATGG - Intergenic
982839318 4:160162061-160162083 CTCTAGGCCAATTGTGATATGGG + Intergenic
986408826 5:7455071-7455093 CTATACCCCACCTGTGAAATTGG + Intronic
986786141 5:11115626-11115648 CTTAAGGCCTTCTGTGAAAGGGG + Intronic
988353010 5:30136616-30136638 TTCTATGCCTCCAGTGAATTGGG - Intergenic
989404755 5:41047830-41047852 CTCCAGGCCTCCAGTGATACTGG + Intronic
989699516 5:44245216-44245238 CTCCAGGCCTCTGGTGTAATTGG + Intergenic
994009530 5:94884707-94884729 TTCTAGGCAGCCTGTCAAATGGG + Intronic
998514676 5:142742209-142742231 GTCTATGTCCCCTGTGAAATAGG + Intergenic
1004962447 6:20805642-20805664 CTGTTGCCCTCCTGTGAATTGGG - Intronic
1006510712 6:34519647-34519669 CTCTGGGCCTTCTGTGCACTGGG + Intronic
1007216374 6:40243029-40243051 CTCTAGGCCTCAGGTGGAAATGG + Intergenic
1009521203 6:64683920-64683942 CTCTGGGCTTACTGTGAAATGGG - Intronic
1009885055 6:69615886-69615908 CTTTAGGCCTCCTAGGATATTGG - Intergenic
1017662036 6:156684422-156684444 CTCTAAGCCTCCTGAGGAAAGGG + Intergenic
1017662578 6:156688208-156688230 CTCTAGGAGTCCGGGGAAATAGG - Intergenic
1017699151 6:157050902-157050924 CTCTAGGCCTCCTATGTAAAAGG - Intronic
1019777498 7:2921318-2921340 TTCTCTGCCTCCTGTGAAAACGG + Intronic
1022169775 7:27814274-27814296 CTCCAGGGCTACTGAGAAATAGG - Intronic
1022415483 7:30173351-30173373 CTCTTGGCCTGCTGAGAAGTCGG + Intergenic
1022629942 7:32075643-32075665 CTCTAGCCCCCCTCTGAAATGGG + Intronic
1024084629 7:45883142-45883164 TTCCAGGTGTCCTGTGAAATTGG + Intergenic
1024572371 7:50733881-50733903 CTCAAGGCCTTCTGTGGATTGGG - Intronic
1025573684 7:62607032-62607054 TTTTAGGCCTCCAGTGAAAAAGG - Intergenic
1028882673 7:95897520-95897542 CTCTAGGCCTCCTATTGAATAGG - Intronic
1029233762 7:99094951-99094973 CCCTGGGCCTCCTGTGATAGTGG - Intronic
1030241451 7:107330935-107330957 GTCTAGGCCTCCTGAGTAGTTGG + Intronic
1034022495 7:147660420-147660442 CACTGGGTCTCCTGTGAAATTGG - Intronic
1034067541 7:148151418-148151440 CTCTCGGCCTCCTGTGTAGCTGG + Intronic
1037323336 8:17664544-17664566 CTCTTGGCCGCCTGGGAAACCGG + Intronic
1038417852 8:27410337-27410359 CTCTAAGGCTCCAGTGGAATGGG - Intronic
1040928300 8:52708584-52708606 CTATAGGCCACCTGTGATAAGGG - Intronic
1047712881 8:127569496-127569518 CCCAAGGCCTCCTGTGGAACTGG - Intergenic
1048119586 8:131564200-131564222 CCCAAGGACTCCTGTGGAATGGG - Intergenic
1052003238 9:23314132-23314154 CTCTAGGCCTCCATGGAAAAGGG - Intergenic
1055440380 9:76331063-76331085 CTGTAGTCCCCCTGGGAAATGGG + Intronic
1056013923 9:82362149-82362171 TTCTTGGTCTCCTTTGAAATAGG + Intergenic
1057769992 9:97958898-97958920 CACTAGGCCTCCAGTGGCATGGG + Intergenic
1060860132 9:126947277-126947299 CTTTCAGCCTCCTGTGAAGTAGG + Intronic
1190931888 X:54955777-54955799 CTCTAGGACTCCTGTAAAGGAGG - Intronic
1193935642 X:87616776-87616798 CTCTAGGTCTCATGAGATATGGG + Intronic
1195129042 X:101837049-101837071 TTCTTGGGCTACTGTGAAATAGG - Intronic
1195177214 X:102322791-102322813 CTCTTGGGCTACTGTGAAATAGG + Intronic
1195181650 X:102364302-102364324 CTCTTGGGCTACTGTGAAATAGG - Intronic
1195254404 X:103078874-103078896 CTCTTGGGCTACTGTGAAATAGG - Intronic
1195314816 X:103667107-103667129 CTCTGTGCCTCTTGTAAAATGGG + Intergenic
1198516354 X:137412072-137412094 GGCTAAGCCACCTGTGAAATGGG + Intergenic
1200754940 Y:6982339-6982361 CTCTCGGCTTCCTGTGTAGTTGG - Intronic
1201851172 Y:18482141-18482163 CTTTAGGACTACTGTGCAATAGG - Intergenic
1201882147 Y:18838237-18838259 CTTTAGGACTACTGTGCAATAGG + Intergenic