ID: 908380551

View in Genome Browser
Species Human (GRCh38)
Location 1:63593614-63593636
Sequence TATCATCTCCACCGTGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908380546_908380551 16 Left 908380546 1:63593575-63593597 CCAGAGCAGCGCCAACTACGCGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 908380551 1:63593614-63593636 TATCATCTCCACCGTGGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 94
908380548_908380551 5 Left 908380548 1:63593586-63593608 CCAACTACGCGGAGAACTTCATC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 908380551 1:63593614-63593636 TATCATCTCCACCGTGGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908380551 Original CRISPR TATCATCTCCACCGTGGAGC CGG Intronic
901322539 1:8348558-8348580 TATCATCCTCAGCGGGGAGCGGG + Intergenic
903656964 1:24955433-24955455 TTTCATCTCCACAATGGAGGTGG + Intronic
908380551 1:63593614-63593636 TATCATCTCCACCGTGGAGCCGG + Intronic
909549530 1:76882343-76882365 TTTCTTCTCCACTGTGGAGAAGG - Intronic
913045365 1:115069322-115069344 CTTCATGCCCACCGTGGAGCTGG - Intronic
913211757 1:116588434-116588456 TACCATCTTCACCAAGGAGCAGG - Intronic
921965564 1:221084779-221084801 TATCATCTTCCCCATGAAGCTGG - Intergenic
923776701 1:236985090-236985112 TCTCACCTCCACTGAGGAGCAGG + Intergenic
1066551202 10:36559474-36559496 TAACATCTCCACCCTGGAAGAGG - Intergenic
1076409585 10:130236385-130236407 TATCTTCTCAACCCTGCAGCTGG - Intergenic
1076849383 10:133085746-133085768 TCTCATCTCCAGGGTGGTGCTGG - Intronic
1082178927 11:49095419-49095441 TAGAATCTCCACCCTGGAACAGG + Intergenic
1085237359 11:75025436-75025458 CATCATCTCCATCGTACAGCTGG - Intergenic
1086642576 11:89178054-89178076 AATGCTGTCCACCGTGGAGCGGG + Exonic
1088332253 11:108665977-108665999 TATCATCCCCACATTGTAGCTGG + Intronic
1089582050 11:119487432-119487454 TATCATCTCCAGTGTGCAGATGG - Intergenic
1093001384 12:14000483-14000505 TATCAGCTCCAACTTTGAGCTGG + Intergenic
1095471307 12:42540197-42540219 TATCCTCTCCACAGTGAAGTGGG - Intronic
1096785508 12:54015080-54015102 TCTAATCTCAACCGTAGAGCTGG + Intronic
1097676352 12:62606305-62606327 TGTCAGCTTCACCATGGAGCGGG - Intergenic
1098782633 12:74706238-74706260 AATCATCACCACAGTGGTGCTGG - Intergenic
1101388785 12:104281335-104281357 TATCATCTCTAGCTTGGACCAGG + Intronic
1101493693 12:105234332-105234354 CTTCATCTCCACCCTGTAGCTGG - Intronic
1102726466 12:115069857-115069879 TATCACCTCCACTGTGCAGGTGG - Intergenic
1105215014 13:18279060-18279082 TAGCATCTTCACCAAGGAGCAGG - Intergenic
1106516191 13:30456079-30456101 TATCATCTCCAGCAAGGAACTGG + Intergenic
1108092071 13:46859485-46859507 TATAATCTCCAATGTGGAGGTGG + Intronic
1113815409 13:113166571-113166593 CTTCCTCTCCACCTTGGAGCTGG - Intronic
1122058038 14:99118260-99118282 TATCATTTACACTGAGGAGCCGG + Intergenic
1133353269 16:5117112-5117134 GAGCATCTCCACCGTCCAGCAGG - Intergenic
1134518731 16:14907879-14907901 GATCGTCCCCACCGTGGGGCAGG - Intronic
1134555197 16:15158337-15158359 GATCGTCCCCACCGTGGGGCAGG + Intergenic
1134706402 16:16306532-16306554 GATCGTCCCCACCGTGGGGCAGG - Intergenic
1134961138 16:18405578-18405600 GATCGTCCCCACCGTGGGGCAGG + Intergenic
1134965440 16:18488181-18488203 GATCGTCCCCACCGTGGGGCAGG + Intronic
1137603207 16:49770458-49770480 TCTCCTTCCCACCGTGGAGCAGG - Intronic
1140687521 16:77447905-77447927 CATTCTCTCCACCATGGAGCTGG + Intergenic
1141146508 16:81534075-81534097 GAGCATCTCCACGCTGGAGCTGG + Intronic
1142059572 16:88020718-88020740 TGTCTTCTCCCCCGAGGAGCAGG - Intronic
1142767376 17:2072574-2072596 GATCATCTCCACCGTAGAGAAGG - Intronic
1147906392 17:43825818-43825840 GCTCATCTCCAACGTGGACCAGG + Exonic
1149567422 17:57649990-57650012 TTTCATCTCCACCCTGGAGAGGG - Intronic
1152134165 17:78494250-78494272 TATCATCTCCCCCACGGGGCAGG - Intronic
1155045511 18:22099893-22099915 TATCATCTCCACCATTCAGTTGG - Intergenic
1157616360 18:48990008-48990030 TATCTCCCCCACCCTGGAGCAGG - Intergenic
1158835079 18:61322280-61322302 TATCATGTCCATTGTTGAGCAGG + Intergenic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160893325 19:1390902-1390924 CATCATCTCCACGGCGCAGCAGG - Exonic
1162438515 19:10678478-10678500 ATTCATCTCCACCCTGGACCAGG - Intronic
1165046604 19:33109401-33109423 TCTCATCCCCACCGAGTAGCCGG - Intronic
1168436346 19:56320659-56320681 AATCATATCCACGGTGGTGCAGG + Intronic
927695995 2:25240211-25240233 TCTCATCTGCATTGTGGAGCTGG - Intronic
930259840 2:49132838-49132860 TATCAGTTTCACCGTGGAACAGG - Intronic
934299306 2:91767677-91767699 TAGCATCTTCACCAAGGAGCAGG + Intergenic
935639199 2:105274750-105274772 TCTCATATCCTCCGTGGTGCTGG - Intronic
942009319 2:171743265-171743287 TATCATCTTCACAGTTGAGTAGG + Intronic
944437104 2:199702130-199702152 TCTCACCTCCACCTTCGAGCAGG - Intergenic
1173353521 20:42266050-42266072 TATCTTCTCAAACCTGGAGCTGG + Intronic
1173361346 20:42347137-42347159 TACCATCTCCATTTTGGAGCAGG - Intronic
1176378122 21:6096823-6096845 TAGAATCTCCCCCGTGGAGGGGG + Intergenic
1178341140 21:31786051-31786073 TAACATCTCCACCAGGGGGCAGG + Intergenic
1179745351 21:43441423-43441445 TAGAATCTCCCCCGTGGAGGGGG - Intergenic
1183123580 22:35752515-35752537 TCCCATCTCTAACGTGGAGCTGG + Intronic
1183689184 22:39378695-39378717 CAGCATCTCCAGCGTGCAGCAGG - Intronic
952423642 3:33153138-33153160 TAATATCTCCAGGGTGGAGCTGG + Exonic
955530703 3:59870032-59870054 TATCATCTCCATTGTATAGCTGG + Intronic
962221595 3:133568939-133568961 AATCATCTCCACCTTACAGCAGG + Intergenic
963968413 3:151400533-151400555 TAGGTTATCCACCGTGGAGCAGG + Intronic
967022683 3:185536266-185536288 CATCATCTCCCACTTGGAGCTGG - Intronic
967459105 3:189724632-189724654 TTGCATCTCTACAGTGGAGCTGG + Intronic
969237380 4:5875334-5875356 TGTCATCTCCACCATGAAGGTGG + Intronic
969573482 4:8023574-8023596 GAGCAAGTCCACCGTGGAGCAGG - Intronic
969813839 4:9671326-9671348 GAGCATCTCCACCGTCCAGCAGG + Intergenic
972691823 4:41406519-41406541 TATCATCCCCTCCCTGGAGAGGG - Intronic
982207212 4:153005750-153005772 TGTCAGCTCTGCCGTGGAGCTGG + Intergenic
985763911 5:1766624-1766646 TTTCATCTCCACCTTGGAGGCGG - Intergenic
986175899 5:5351674-5351696 GAGCTTCTGCACCGTGGAGCTGG - Intergenic
987128875 5:14842162-14842184 TACCATCTCCACCTTACAGCAGG - Intronic
1001797353 5:174513600-174513622 TATCTTCACCACCATGGAGAAGG + Intergenic
1004877708 6:19972425-19972447 TATCATATTCATCCTGGAGCTGG + Intergenic
1012941827 6:105423766-105423788 TGTCCTCTCCACCTTGGAACAGG + Intergenic
1017774951 6:157673213-157673235 TGTCATCTCCACCGTGGCATTGG - Exonic
1023694580 7:42831590-42831612 CACTATCTCCACCGTGGAGAGGG + Intergenic
1024262572 7:47582998-47583020 TTTCATCTGCCACGTGGAGCAGG + Intergenic
1024622617 7:51175165-51175187 TACCTTTTCCACCTTGGAGCAGG + Intronic
1024712161 7:52027778-52027800 TCTCATCACCTCCGTGGGGCGGG + Intergenic
1032215267 7:129952637-129952659 TGCCACCTCCACCGAGGAGCCGG - Exonic
1033598991 7:142875760-142875782 TATCATCACCACCAAGAAGCGGG - Exonic
1039878077 8:41604521-41604543 TACCATCACCACTGTGGAGGGGG - Intronic
1045852101 8:106714351-106714373 TTTCATCTCCTCCATGGAGGAGG + Intronic
1047361533 8:124173765-124173787 TACCATCTCCACTGGAGAGCAGG + Intergenic
1049872854 8:144994548-144994570 TGTCATCTCCAGGCTGGAGCGGG - Intergenic
1051798424 9:20903070-20903092 TCTCATCTTGACCGTGGTGCTGG - Intronic
1057442718 9:95093659-95093681 TACCGTCTCCACCCTGGCGCCGG + Intergenic
1062038651 9:134394051-134394073 TGCCATCTGCACAGTGGAGCAGG + Intronic
1062069718 9:134549144-134549166 TGTCATCTCCACCGATGAGGAGG + Intergenic
1185501362 X:599296-599318 TATCATCCCCACCCTTGAGAAGG - Intergenic
1193872474 X:86817411-86817433 ATTCATCTCTACCATGGAGCTGG - Intronic