ID: 908382122

View in Genome Browser
Species Human (GRCh38)
Location 1:63606544-63606566
Sequence CAGGGGAGAAAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3646
Summary {0: 2, 1: 2, 2: 93, 3: 999, 4: 2550}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908382111_908382122 12 Left 908382111 1:63606509-63606531 CCACCACCTTACCTTCATGCCAG No data
Right 908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG 0: 2
1: 2
2: 93
3: 999
4: 2550
908382114_908382122 1 Left 908382114 1:63606520-63606542 CCTTCATGCCAGCTAACATGCCA 0: 1
1: 0
2: 2
3: 12
4: 133
Right 908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG 0: 2
1: 2
2: 93
3: 999
4: 2550
908382110_908382122 13 Left 908382110 1:63606508-63606530 CCCACCACCTTACCTTCATGCCA No data
Right 908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG 0: 2
1: 2
2: 93
3: 999
4: 2550
908382118_908382122 -7 Left 908382118 1:63606528-63606550 CCAGCTAACATGCCAACAGGGGA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG 0: 2
1: 2
2: 93
3: 999
4: 2550
908382112_908382122 9 Left 908382112 1:63606512-63606534 CCACCTTACCTTCATGCCAGCTA 0: 1
1: 0
2: 1
3: 18
4: 186
Right 908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG 0: 2
1: 2
2: 93
3: 999
4: 2550
908382113_908382122 6 Left 908382113 1:63606515-63606537 CCTTACCTTCATGCCAGCTAACA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG 0: 2
1: 2
2: 93
3: 999
4: 2550
908382109_908382122 25 Left 908382109 1:63606496-63606518 CCGGGATGGCTGCCCACCACCTT 0: 1
1: 0
2: 2
3: 17
4: 240
Right 908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG 0: 2
1: 2
2: 93
3: 999
4: 2550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908382122 Original CRISPR CAGGGGAGAAAGATGGAGGA AGG Intronic
Too many off-targets to display for this crispr