ID: 908383502

View in Genome Browser
Species Human (GRCh38)
Location 1:63618730-63618752
Sequence GGCCAAGGGTCTGGATGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 1, 2: 3, 3: 35, 4: 345}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908383491_908383502 19 Left 908383491 1:63618688-63618710 CCAGTTGAATTGGGGTGACACCA 0: 1
1: 0
2: 0
3: 7
4: 101
Right 908383502 1:63618730-63618752 GGCCAAGGGTCTGGATGTGGAGG 0: 1
1: 1
2: 3
3: 35
4: 345
908383490_908383502 24 Left 908383490 1:63618683-63618705 CCTTTCCAGTTGAATTGGGGTGA 0: 1
1: 0
2: 1
3: 7
4: 115
Right 908383502 1:63618730-63618752 GGCCAAGGGTCTGGATGTGGAGG 0: 1
1: 1
2: 3
3: 35
4: 345
908383496_908383502 -1 Left 908383496 1:63618708-63618730 CCAGCTGGGTGAGGTGTGGCTCG No data
Right 908383502 1:63618730-63618752 GGCCAAGGGTCTGGATGTGGAGG 0: 1
1: 1
2: 3
3: 35
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908383502 Original CRISPR GGCCAAGGGTCTGGATGTGG AGG Intronic
900141686 1:1141487-1141509 GGACAGGGGTGGGGATGTGGTGG - Intergenic
900156710 1:1206114-1206136 GGTCTGGGGTCTGGAGGTGGAGG - Intronic
900926476 1:5709375-5709397 AGCCAAGGATATGGATGTGGTGG + Intergenic
901769632 1:11523813-11523835 GGCCCAGGGACTGGAGGGGGTGG - Intronic
901928039 1:12579301-12579323 GGCCCAGGGTGTTGATGTGTTGG + Exonic
902511509 1:16969347-16969369 GGCCCAGGGTCTGGCTGGGGTGG + Intronic
902676299 1:18010837-18010859 GGTCAAGGGTGGGGATGTAGTGG - Intergenic
902686809 1:18082750-18082772 GACCATGGGTCTGGATGAGCTGG + Intergenic
902797958 1:18811597-18811619 CGCCAAGGGTCTGGCTTTGTGGG + Intergenic
903428752 1:23275229-23275251 GGGCAATGAGCTGGATGTGGTGG + Intergenic
903789930 1:25885912-25885934 GGCCAAGGGACAGGAGGTGGAGG + Intronic
903950730 1:26994471-26994493 GGCCAGGGGTCCGGGCGTGGAGG - Exonic
904415959 1:30361381-30361403 GGCCCAGGTTCTGGGTGGGGGGG + Intergenic
904626249 1:31805537-31805559 GGGCCAGGGTCTGGCTGTGTTGG - Intronic
905021115 1:34813038-34813060 GGGCAAGGGTGTGGATGCAGGGG - Intronic
905257005 1:36691306-36691328 GGCCAAGGGAGAGGAAGTGGTGG - Intergenic
905645622 1:39623298-39623320 GGCCAAGGGACTGGAAGTTCTGG - Intergenic
906044316 1:42816703-42816725 GGCAAGGGCGCTGGATGTGGGGG + Intronic
906562954 1:46772819-46772841 GGCCAAGGGTTTTTGTGTGGTGG - Intronic
908208424 1:61874482-61874504 GCCCAAGGGGCTGGGTGTGGTGG - Intronic
908383502 1:63618730-63618752 GGCCAAGGGTCTGGATGTGGAGG + Intronic
908643413 1:66250249-66250271 GACCAAGAGTCTAGATGTGAAGG + Intronic
911319455 1:96395110-96395132 GGCCAAGGGTGGTGCTGTGGAGG + Intergenic
911706268 1:101016732-101016754 AGCCAAGAGGCTGGGTGTGGTGG - Intronic
912392557 1:109314320-109314342 GGCCAATGGTGTGGATGGTGTGG - Exonic
912817114 1:112838161-112838183 GGGAAAGGGGCTGGATGTTGAGG - Intergenic
913977689 1:143476640-143476662 GGCCATGGGTCTGGATTTCCAGG - Intergenic
914072093 1:144302269-144302291 GGCCATGGGTCTGGATTTCCAGG - Intergenic
914107062 1:144664087-144664109 GGCCATGGGTCTGGATTTCCAGG + Intergenic
915912732 1:159924604-159924626 GGCCCAGGGTGTGGTCGTGGGGG - Intronic
916679598 1:167092123-167092145 GGCCAAACGGCTGGACGTGGTGG - Intergenic
918070041 1:181128061-181128083 GGCCAAGGTGGTGGTTGTGGTGG + Intergenic
919445109 1:197693834-197693856 GGCCATAGTTCTGGATGTGGGGG - Intronic
920701190 1:208219159-208219181 CACCAAGGCTCTGGAAGTGGAGG - Intronic
922353597 1:224755931-224755953 GGCCAGGGGCCAGGATGGGGTGG + Intergenic
923781512 1:237029668-237029690 GGTCAGGAGTCTGGATGCGGTGG + Intergenic
924800194 1:247323825-247323847 CTCTTAGGGTCTGGATGTGGTGG + Intronic
1064337759 10:14458990-14459012 GGTCCTGGGCCTGGATGTGGAGG + Intronic
1064351132 10:14578056-14578078 CGCCCTGGCTCTGGATGTGGAGG - Intronic
1065892059 10:30129915-30129937 GGCTCAGGGTGTGGATGGGGAGG - Intergenic
1066330020 10:34411321-34411343 GGCCAAATGTCTGGATGTCATGG - Intronic
1067170006 10:43898651-43898673 GGCAAAGGGGGTGGAGGTGGTGG - Intergenic
1069674451 10:70237680-70237702 GTTCAAGAGACTGGATGTGGTGG + Intergenic
1070162146 10:73873304-73873326 TGCCCAGGGACTGGATGAGGGGG - Intronic
1070486733 10:76938918-76938940 TGCTAAGGGTTTGGATTTGGGGG - Intronic
1070665707 10:78342012-78342034 GGTAAAGGGGCTGAATGTGGAGG + Intergenic
1070718947 10:78743289-78743311 GGCCAAGGGGCAGGATGTGCTGG - Intergenic
1070742331 10:78911267-78911289 AGCCAAGTTTCTGGATGTGTGGG - Intergenic
1071278420 10:84077328-84077350 GGTCCAGGGGCTGGGTGTGGTGG + Intergenic
1071505450 10:86228976-86228998 GAACAAGGGTGTGGGTGTGGAGG + Intronic
1071598911 10:86946780-86946802 AGCTCAGGGTGTGGATGTGGAGG + Intronic
1072484759 10:95844497-95844519 AGACAGGGTTCTGGATGTGGTGG + Exonic
1072652155 10:97304103-97304125 GGTCAAGGGGCTGCATCTGGTGG - Intergenic
1073479533 10:103777710-103777732 GGCCATGGGTCAGCAGGTGGGGG - Intronic
1074364427 10:112846477-112846499 GGCCAGTGGGCGGGATGTGGTGG + Intergenic
1074749322 10:116568655-116568677 GGCAAAATGTCTGGGTGTGGTGG - Intergenic
1076080559 10:127576667-127576689 GGCACAGGTTCTGGATGAGGAGG + Intergenic
1076819192 10:132930363-132930385 GGCCCAGGCTCTGTATGGGGAGG - Intronic
1077095058 11:795726-795748 GGGCAAGGGGCTGGCTGTGGGGG - Intronic
1077111549 11:864262-864284 GGCCAAGGGTTCTGAGGTGGGGG + Intronic
1077603920 11:3594218-3594240 AGCAAAGGGTCTGGCTGAGGTGG - Intergenic
1078131605 11:8618608-8618630 GGCTAAGGGGCTGGAAGTGAGGG + Intronic
1078351125 11:10594309-10594331 GCCCAAGGGTCTGGGTGTTGGGG + Intronic
1079185117 11:18229798-18229820 GGCCAAGGGTCTGAAAATGTAGG - Intronic
1079370338 11:19846978-19847000 GGCCAAGGGGATGAATTTGGTGG - Intronic
1080386694 11:31814725-31814747 GGACAAAGGCCTGGAAGTGGGGG - Intronic
1080687510 11:34527466-34527488 GGAAAAGGGGCTGGCTGTGGTGG + Intergenic
1084078117 11:66798310-66798332 GGTGAAGGGGCTGGGTGTGGTGG + Intronic
1084174976 11:67418346-67418368 GGCCGTGGGTGTGGAGGTGGTGG + Intronic
1084187748 11:67483825-67483847 GGCAGAGGGGCTGGATCTGGGGG - Intronic
1084480043 11:69414897-69414919 GGTCCTGGGTCAGGATGTGGGGG - Intergenic
1084670404 11:70603434-70603456 GGGTCAGGGTCAGGATGTGGAGG - Intronic
1084803878 11:71565675-71565697 GGCTATGGCTCTGGCTGTGGGGG + Exonic
1085429551 11:76435894-76435916 TGCCAAGGGTTTGGAGTTGGGGG - Intergenic
1087907002 11:103709953-103709975 GGCCAAGGGTCAGGAGGTGGGGG - Intergenic
1088386153 11:109258694-109258716 CCCCAATGGGCTGGATGTGGTGG - Intergenic
1089743508 11:120601116-120601138 GGTCCAGGGGCTGGGTGTGGTGG + Intronic
1090609585 11:128458297-128458319 GGCCAAGGAGATGGATGTGAAGG + Intergenic
1091349261 11:134879889-134879911 GGACAAGGGGCTGCATATGGAGG + Intergenic
1091796049 12:3297985-3298007 TGCCAAGGCTCTGGCTGTGAGGG + Intergenic
1091844506 12:3645495-3645517 AGCCAAGGGGCTGGGGGTGGTGG + Intronic
1091890671 12:4051730-4051752 GGCCAATGCTGTGGTTGTGGTGG + Intergenic
1092287879 12:7140146-7140168 TGCTAATGGACTGGATGTGGAGG + Intronic
1092364225 12:7863415-7863437 GGCCATGTGTCTGGAATTGGTGG - Intronic
1094192650 12:27712727-27712749 TGCCAAGGGGCTGAGTGTGGGGG + Intronic
1094708384 12:32936908-32936930 GGCCATGGATCTTGGTGTGGTGG + Intergenic
1095402357 12:41829604-41829626 TGGCAAGGGGCTGGATGTGGTGG + Intergenic
1095952708 12:47790347-47790369 GGCCCAGGGACTGGGTTTGGGGG - Intronic
1098199170 12:68036544-68036566 AGCCAAGGCTATGGAAGTGGTGG + Intergenic
1098845339 12:75528379-75528401 GGGCAAGTGTCTGGCAGTGGTGG + Intergenic
1099460119 12:82911197-82911219 GCCCCAGGGTTTGGGTGTGGGGG + Intronic
1100449373 12:94690717-94690739 CACCAAGGGTCTGGAGGCGGAGG + Intergenic
1100555209 12:95686469-95686491 GGGCAAGGGGCTGGGCGTGGTGG + Intronic
1102188325 12:110966642-110966664 GGCCAAGTGTCAGGATATTGAGG + Intergenic
1102466225 12:113132357-113132379 GGCCAGGGGTGGGGAAGTGGGGG - Intronic
1102969895 12:117158027-117158049 GGTCTAGGGTTTGGATGTGCTGG + Exonic
1103170901 12:118819050-118819072 GGCAAAGTGACTGGATATGGTGG + Intergenic
1103270260 12:119667908-119667930 GGCCTAGGGCGTGGAGGTGGCGG - Exonic
1103809676 12:123603331-123603353 TGCTAAGGGACTGGAAGTGGAGG + Intronic
1103813758 12:123636628-123636650 AGCCAAGTGGCTGGGTGTGGTGG + Intronic
1103891814 12:124244888-124244910 GGCAAAAGGGCTGGGTGTGGCGG - Intronic
1103949261 12:124542343-124542365 TGCCAAGGGTGTGGCTGTTGTGG - Intronic
1104349904 12:128035989-128036011 GCCCCAGGGCCTGGCTGTGGAGG - Intergenic
1104616755 12:130276918-130276940 GACCAAGAGGCTGGATTTGGGGG - Intergenic
1105541487 13:21320601-21320623 GGTCAAGGGTGTGGAGCTGGAGG + Intergenic
1105825032 13:24114947-24114969 AGCCAAGGGGCTGGGTGTAGTGG - Intronic
1106027437 13:25968446-25968468 GGCCGAGGCTCGGGAAGTGGTGG - Intronic
1106456357 13:29930694-29930716 GCCAAAGGGGCTGGGTGTGGTGG - Intergenic
1108229082 13:48318757-48318779 GGCCACTGGTCTGGCTGTTGGGG + Intronic
1112173954 13:97002757-97002779 TGGACAGGGTCTGGATGTGGAGG + Intergenic
1112698831 13:101980952-101980974 GCCCCAGGGGCTGGGTGTGGTGG + Intronic
1114270529 14:21098002-21098024 GGCCAACGGGGGGGATGTGGCGG - Intronic
1114960925 14:27888164-27888186 AGCCAAGGATCAGGGTGTGGGGG + Intergenic
1117751084 14:58924343-58924365 GGCCATGAGTCTGGATGAGTGGG + Intergenic
1117831138 14:59752078-59752100 GGGCAGAGGTGTGGATGTGGAGG - Intronic
1118599146 14:67459173-67459195 AGCCAAGTGGCTGGCTGTGGTGG - Intronic
1119295742 14:73531695-73531717 GACCAAGAGGCTGGGTGTGGTGG - Intronic
1119479584 14:74951213-74951235 GGCCTAGGGGCTGGTGGTGGGGG + Intronic
1120240009 14:81939029-81939051 GGCCAAGGTTCTGAATTTGAAGG - Intergenic
1120910210 14:89659448-89659470 GGCCAAGGGTCTGGAAGCCAGGG - Intergenic
1120954306 14:90068173-90068195 GGCCAAGGATGTGGGAGTGGAGG - Intronic
1121005637 14:90489116-90489138 GGCGAGGGTTCTGGAGGTGGAGG + Intergenic
1121175938 14:91890696-91890718 AGCAAAGGGTCTGGTGGTGGTGG - Intronic
1121210630 14:92205970-92205992 GAATAAGGGTCTGGATGCGGTGG - Intergenic
1123060446 14:105592001-105592023 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123084924 14:105712972-105712994 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123449521 15:20351190-20351212 ACTCAAGGGTCTGGATGTGGGGG + Intergenic
1124498875 15:30209118-30209140 GGGCACTGGGCTGGATGTGGTGG + Intergenic
1125366926 15:38927290-38927312 GGCAAAGGGGCTGGGTGTGGTGG - Intergenic
1125883401 15:43211584-43211606 GGACAGAGGCCTGGATGTGGAGG - Intronic
1126047547 15:44656645-44656667 TGCCTAGGGTATGGCTGTGGAGG + Intronic
1126487930 15:49203336-49203358 GGCAAATGGTCTCGGTGTGGTGG - Intronic
1126816182 15:52457152-52457174 GGCAAAGGGGCTTGGTGTGGTGG + Intronic
1126850209 15:52791837-52791859 GGCCAAGGCTGTGGTAGTGGTGG + Intergenic
1128350902 15:66887742-66887764 GGCCAAGGTCTTGGAGGTGGAGG + Intergenic
1128884265 15:71272113-71272135 GGCAAAGGGGCTGGGTGTGGTGG + Intronic
1129238238 15:74236524-74236546 GCCCTGGGGCCTGGATGTGGGGG - Exonic
1129342810 15:74897268-74897290 TGGCAAGGGTCACGATGTGGAGG + Intronic
1129470277 15:75749972-75749994 GCTCATGGGTATGGATGTGGAGG - Intergenic
1130679224 15:85981650-85981672 GCCCAAGTGGCTGGGTGTGGTGG - Intergenic
1132170735 15:99651531-99651553 GGGCAGGGGACTGGAGGTGGAGG - Intronic
1132408492 15:101559727-101559749 AGCCAGGGCTGTGGATGTGGGGG + Intergenic
1133006317 16:2883548-2883570 GGACAAGGGACTGGAGGGGGTGG - Intronic
1134143978 16:11745327-11745349 GGCCAAGAGGCTGGGCGTGGTGG - Intergenic
1136418239 16:30116466-30116488 GCCCAGGGGGCTGGGTGTGGTGG - Intronic
1137668826 16:50267441-50267463 AGCCAAGGGCCTGGAGGTAGGGG + Intronic
1138599774 16:58047531-58047553 GGCCAAGAGCATGGATGTGGGGG - Intergenic
1139593671 16:67946528-67946550 GGCCACAGGACTGGATGAGGTGG + Exonic
1139968364 16:70758248-70758270 GGGCCAGGGTCTGGGTGAGGGGG + Intronic
1140615448 16:76657476-76657498 GGACAAAGGCCTGGATGTGGAGG - Intergenic
1142666945 17:1468659-1468681 GGCAGAGGGTCAGGAAGTGGAGG - Intronic
1143026221 17:3943501-3943523 GGCCAAGGGTGTGTATGAGAAGG - Exonic
1143174854 17:4949911-4949933 GGCCAGGGGTCAGGAGATGGCGG - Intronic
1143179171 17:4973592-4973614 GGCTCAGGGTCTCGATGAGGCGG + Exonic
1143253299 17:5538107-5538129 TGAGAAGGCTCTGGATGTGGGGG + Intronic
1143695316 17:8610742-8610764 GGTCAAGGGGCTGCATCTGGTGG - Intronic
1144594415 17:16555483-16555505 GCCCAAGACTCTGGATATGGTGG + Intronic
1145999303 17:29121822-29121844 GGGCAGGGGGCTGGGTGTGGGGG - Intronic
1147140214 17:38456449-38456471 GGCTGAGGGGCTGGGTGTGGAGG - Intronic
1147263067 17:39219941-39219963 TGCCAAGGGGATGGAAGTGGTGG + Intronic
1147338238 17:39739533-39739555 GGCCAGGGGCCTGGATGTGGCGG - Intronic
1148019260 17:44542565-44542587 GGCCAAGGGGGTGGGGGTGGGGG + Intergenic
1148427346 17:47610667-47610689 AGCCGGGGGTCTGGGTGTGGTGG - Intronic
1148451067 17:47778212-47778234 GGCCCAGGGGTGGGATGTGGCGG + Intergenic
1148856755 17:50583161-50583183 GACCAAGGGACTGGCTGGGGTGG - Intronic
1150136934 17:62701255-62701277 GGCCAAGGGTCTCAAGCTGGAGG - Intergenic
1150388827 17:64779641-64779663 GTCCAAGGGCCTTGGTGTGGGGG + Intergenic
1150685964 17:67321154-67321176 AAAGAAGGGTCTGGATGTGGTGG + Intergenic
1151657635 17:75503135-75503157 GGCCAAGGGTCCGGAGCTGATGG - Exonic
1152076303 17:78161986-78162008 GCCCCAGGGGCTGGGTGTGGTGG + Intronic
1152090356 17:78243259-78243281 AGCCAGGTGGCTGGATGTGGTGG - Intergenic
1152365036 17:79850653-79850675 GGAAAAGGGGCTGGGTGTGGTGG - Intergenic
1152445368 17:80339755-80339777 GGCCAAGGGTCTCTAGGTCGAGG - Exonic
1152888803 17:82868142-82868164 GGCGCGGTGTCTGGATGTGGAGG + Intronic
1152997015 18:416940-416962 GGGCAAGGGCATGGATGTGTGGG + Intronic
1155123122 18:22842951-22842973 GGCCAAGGGTCTTAATCTGGGGG - Intronic
1156029080 18:32691389-32691411 GCCAAAGAGTCTGGGTGTGGTGG + Intronic
1156325530 18:36071504-36071526 GGCCAAGGGGCTGGGGGCGGGGG + Intergenic
1156523790 18:37746891-37746913 GGCCAAGCAGCTGGAGGTGGTGG + Intergenic
1157337041 18:46748257-46748279 GGCAAAGGGGCTGGGCGTGGTGG + Intronic
1157785117 18:50474597-50474619 GGCCAAGGGACTGGGGGTTGTGG - Intergenic
1158933662 18:62345202-62345224 GGAAAAGGGTCTGCAAGTGGAGG + Intronic
1160431307 18:78814652-78814674 GGCCAAGCCTCAGGATGCGGGGG - Intergenic
1160575183 18:79849108-79849130 GGCAGAGGGGCTCGATGTGGAGG - Intergenic
1160691631 19:462953-462975 GGCTACGGGTCTGGCTCTGGAGG + Intergenic
1160807463 19:998702-998724 GGCCAGGGGGCTGGAGGGGGTGG + Intergenic
1160936187 19:1596404-1596426 GGCCAGGGGTCTGTGCGTGGTGG - Intergenic
1161092249 19:2367237-2367259 GCCCAAGGTTATAGATGTGGTGG - Intergenic
1161106132 19:2444948-2444970 GGCCAAGGGGCTGCATGTCCAGG - Intronic
1161291066 19:3493723-3493745 GGCAGAGGGACTGGACGTGGGGG + Intronic
1161429776 19:4224765-4224787 GGGCTGGCGTCTGGATGTGGAGG - Exonic
1161576739 19:5058559-5058581 GGGCCAGGGCCTGGGTGTGGTGG + Intronic
1161857363 19:6773401-6773423 CCCCCAGAGTCTGGATGTGGGGG + Intronic
1162030072 19:7913460-7913482 GGCAGAGGGAGTGGATGTGGGGG + Exonic
1162134312 19:8545744-8545766 GGAAAAGGGGGTGGATGTGGGGG + Intronic
1162300436 19:9841973-9841995 GGGCATGGGTCTGGGTGTGGTGG + Intronic
1162849778 19:13422031-13422053 GTTCAATGGGCTGGATGTGGTGG + Intronic
1162943908 19:14031192-14031214 GGTCAGGGGTCAGGATGGGGGGG - Intergenic
1163541263 19:17912170-17912192 GGGCATGGGGCTGGGTGTGGTGG - Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164676117 19:30102892-30102914 TTCCAAGGGTCTGGATCTGCGGG + Intergenic
1165227552 19:34365446-34365468 GGCCTGGGGTCTGGAGGCGGGGG + Intronic
1165245566 19:34496650-34496672 TGGCAAGTGTCTGGATGTGGGGG + Intronic
1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG + Intronic
1166407780 19:42533827-42533849 GGCAAAGGGGCTGGATGCGGTGG + Intronic
1168297393 19:55384118-55384140 GGCCGTGGCGCTGGATGTGGCGG - Exonic
1168723911 19:58570424-58570446 GGCCCAGGCTCTGGAGTTGGAGG + Exonic
925152198 2:1622665-1622687 GGTCATGGGTCTGGAGGAGGGGG + Intergenic
925413994 2:3656803-3656825 GGGCAGGGGTCAGGGTGTGGAGG + Intergenic
925730226 2:6914819-6914841 AGACAAGGGGCTGGGTGTGGTGG - Intergenic
926146474 2:10399641-10399663 GGCCAATGGTGTGAATGTGCTGG - Intronic
926715590 2:15921423-15921445 GGCCAATGGTGTGGGTGGGGTGG + Intergenic
927518892 2:23687629-23687651 GTCCAAGGGCCTGGCTGTGGGGG + Intronic
929647393 2:43641078-43641100 GGGCAAAGGCCTGGACGTGGTGG - Intronic
929914485 2:46122817-46122839 GTCCAATGGTCAGGAAGTGGGGG + Intronic
929992525 2:46802135-46802157 GGCCAAGGGGCTGTAGGAGGTGG - Intergenic
932081258 2:68717395-68717417 GGCCCAGGGTCAGGATGTTGAGG + Intronic
933772574 2:85753712-85753734 GGCCAAGGGGATGGGGGTGGGGG + Intronic
934182396 2:89637635-89637657 GGCCATGGGTCTGGATTTCCAGG - Intergenic
934292694 2:91711840-91711862 GGCCATGGGTCTGGATTTCCAGG - Intergenic
934308803 2:91845355-91845377 GGCCAAGTGGCTGCATGTGAGGG + Intergenic
936285331 2:111177056-111177078 GGGCAAGGGTGTGCCTGTGGAGG - Intergenic
937884457 2:126890353-126890375 GGCCTGGGGTCTCCATGTGGAGG - Intergenic
943029138 2:182666328-182666350 AGACAAGGGGCTGGGTGTGGTGG + Intergenic
944531780 2:200674415-200674437 GGTCAAGGGCCTGGGTGGGGGGG + Intronic
948800549 2:240431492-240431514 GGCCAAGAGTCAGGGTGGGGAGG + Intergenic
948811798 2:240482193-240482215 GCCCAGGGGCCTGGATGTGAAGG - Exonic
948947588 2:241228926-241228948 GGCTGAGGGTCTGGCAGTGGAGG + Exonic
1169157414 20:3343600-3343622 GGCAAAGGGGTTGGCTGTGGGGG - Intronic
1169539141 20:6580918-6580940 GGCCAAGGGATGGGATGGGGTGG - Intergenic
1172101320 20:32484955-32484977 AGCGGAGGGTCTGGATTTGGAGG - Intronic
1172672253 20:36642554-36642576 TGCAAAGAGGCTGGATGTGGTGG - Intronic
1173707932 20:45126660-45126682 TTCCAAGGGTCTGGGGGTGGGGG - Intergenic
1173802492 20:45903167-45903189 GGCAAGGGGTTTGGGTGTGGTGG - Intronic
1174375736 20:50125311-50125333 GGCCAAGGAACTGGAAGTGGGGG + Intronic
1178690138 21:34743735-34743757 TGAAAAGTGTCTGGATGTGGTGG + Intergenic
1180854494 22:19037571-19037593 GGCCAAGCGTCTGCAGGTGAGGG - Exonic
1181029291 22:20142211-20142233 GGCCAAGGGTCTGAGTCTGCAGG + Intronic
1181294162 22:21821784-21821806 GATGAAGAGTCTGGATGTGGTGG + Intronic
1181774111 22:25147516-25147538 GGGCAAAGGACTGGAGGTGGGGG - Intronic
1182079035 22:27516138-27516160 GGCCAAGGGCATGGATGCTGGGG - Intergenic
1183103176 22:35596463-35596485 TGCAAAGGGGCTGGGTGTGGTGG + Intergenic
1183251182 22:36731605-36731627 GCCCAAGAGTATGGATGTGTGGG - Intergenic
1183377728 22:37474716-37474738 GCCCACGGCTCTGGGTGTGGAGG - Intronic
1183545704 22:38454046-38454068 GGTCATGGGACTGGATGTGGGGG + Intronic
1183745724 22:39690589-39690611 GGCCGAGCCTCTGGCTGTGGAGG - Intergenic
1183753310 22:39735067-39735089 GGCCCAGGAACTGGATGTTGGGG + Intergenic
1184187707 22:42875958-42875980 AGCCAATTGGCTGGATGTGGTGG - Intronic
1184526686 22:45028034-45028056 GGAAGAGGGGCTGGATGTGGTGG + Intergenic
1185370219 22:50457425-50457447 GACAAAGGGCCAGGATGTGGAGG - Intronic
949862816 3:8522023-8522045 GGCCCAGGGTCTGGGTGTTTTGG + Intronic
950111533 3:10421768-10421790 AGCCACGGGTCTGCATGTGCCGG + Intronic
950209031 3:11104199-11104221 GGCAAAAGGGCTGGGTGTGGTGG - Intergenic
950505718 3:13393241-13393263 GGACAAGGGGATGGAGGTGGGGG + Intronic
953445101 3:42956821-42956843 GGCCTAAGGTCAGTATGTGGTGG + Intronic
953587800 3:44220947-44220969 GCCCAAGAGTCTGGAGGTGTAGG + Intergenic
953947680 3:47163681-47163703 GGCCAAGCGGCTCGAAGTGGCGG + Intronic
954462029 3:50632746-50632768 GGCCAGGGGTATGGAGGTTGGGG + Intronic
954539289 3:51383071-51383093 GGCCCAGGGCCTGGCTGTGGAGG - Exonic
954690234 3:52391814-52391836 GACCAGGGATCTGGATGAGGTGG - Intronic
954716119 3:52527772-52527794 GGCCAGGGCTCTGGGTGGGGAGG - Intronic
954743147 3:52770759-52770781 GGCCCAGAGTCGGGATGCGGCGG + Exonic
955302609 3:57796890-57796912 AGGCAAGGGGCTGGATATGGTGG + Intronic
955790038 3:62579617-62579639 GGACAAGGGTCTTGAGATGGGGG + Intronic
959262559 3:104100276-104100298 GGCAAAGGGGCTGGGCGTGGTGG - Intergenic
961485454 3:127212767-127212789 GGCCATGTGTTGGGATGTGGGGG - Intergenic
961797846 3:129422570-129422592 TGCCCAGGGTGTGGATGGGGAGG - Intronic
962874582 3:139526193-139526215 GGCCAAGGTTCTGGATAAGGAGG + Intronic
964100945 3:152988000-152988022 GGACAAAGGTCTGCATGTGGTGG + Intergenic
964921873 3:161907055-161907077 TGCCTAGGGTATTGATGTGGGGG - Intergenic
965320436 3:167247125-167247147 GGCCCAGGATGGGGATGTGGTGG - Intronic
965356797 3:167685122-167685144 GGCCCAGGGACTGGACCTGGTGG + Intronic
968704554 4:2071889-2071911 GGCCAAGTGGCTGGGGGTGGTGG + Intergenic
968775226 4:2536351-2536373 GGCCAGGGAGCTGGATGCGGCGG - Intronic
968868042 4:3226315-3226337 ATTCAAGGGTCTGGGTGTGGTGG + Intronic
969530150 4:7726031-7726053 CCCCATGGGTGTGGATGTGGAGG - Intronic
969746966 4:9080156-9080178 GGCCAAGGCTCTGGGGCTGGAGG - Intergenic
970155468 4:13137257-13137279 GGTCAAGGGTCTGCAGGTTGAGG + Intergenic
971253056 4:24989262-24989284 GGCCAAGGCTCTGGATGTGGGGG + Intergenic
972311955 4:37890704-37890726 GCGCAGGGGTCTGGATGGGGCGG + Intergenic
974005656 4:56553846-56553868 GGCCAAGGGTTTGGAGAGGGAGG - Intronic
974477689 4:62405193-62405215 GACAAAGGGTTTGGATGGGGAGG - Intergenic
975593213 4:76020699-76020721 GGCCATAGGGCTGGATGTGGTGG + Intronic
976378638 4:84374352-84374374 GGCAAAGGGTCTAGATGTTATGG + Intergenic
976386827 4:84469743-84469765 AGCCAAGGGGCCGGACGTGGTGG + Intergenic
976937081 4:90649817-90649839 GGTCAAGGGGCTGGGTGTGGTGG + Intronic
977580417 4:98718559-98718581 GGGAAAGGGTCTGGGTGCGGTGG - Intergenic
981811787 4:148783845-148783867 GGAGAAGGGGCTGGGTGTGGGGG - Intergenic
982797070 4:159659147-159659169 GGGCAAGGGGCTGGGTGAGGAGG - Intergenic
1202767666 4_GL000008v2_random:163124-163146 GACCAAGGCCCTGGAGGTGGGGG + Intergenic
988489334 5:31693157-31693179 GGTGAAGAGTCTGGGTGTGGGGG + Intronic
990599869 5:57347471-57347493 GGTCAAGGGGCTGCATCTGGAGG + Intergenic
992186925 5:74252886-74252908 GGCCAAGGGTATGGGTGGGAGGG - Intergenic
992716017 5:79512873-79512895 GGACAAGGATCTGGGGGTGGGGG - Exonic
993006998 5:82439412-82439434 GGCAGAGAGGCTGGATGTGGTGG + Intergenic
993562583 5:89429231-89429253 GTCCAAGAGACTGGATGAGGGGG + Intergenic
994660419 5:102647398-102647420 GGCAAAAGGGCTGGGTGTGGTGG + Intergenic
997500234 5:134368143-134368165 GGGCAGGGGTGTGGAGGTGGGGG - Intronic
998210596 5:140194484-140194506 GGACCAGGGCCTGGATATGGTGG - Exonic
998400899 5:141848681-141848703 GTGCCAGGGTCTGGAGGTGGAGG - Intergenic
999020347 5:148158702-148158724 GCCAAAGGGGCTGGGTGTGGTGG - Intergenic
999314589 5:150575549-150575571 GGCCCAGGCTGGGGATGTGGGGG + Intergenic
1001293885 5:170485418-170485440 GGCCCAGGGTGTGGACGGGGAGG + Intronic
1001793285 5:174480079-174480101 GGACCAGGGCCTGGATGTGGTGG - Intergenic
1002341095 5:178516994-178517016 GGCCCAGTGTGTTGATGTGGAGG - Intronic
1003193184 6:3891923-3891945 AGCTAAGGGTCTGGCTGTAGTGG - Intergenic
1005339615 6:24831051-24831073 GGGAAAGGGTGTGTATGTGGGGG + Intronic
1005342023 6:24851962-24851984 GGTTCAGGGGCTGGATGTGGTGG + Intronic
1006510171 6:34517171-34517193 TGCCGATGGTTTGGATGTGGCGG - Intronic
1007790689 6:44306581-44306603 GGCCCAGGGTGGGGAGGTGGGGG - Intronic
1010666283 6:78633613-78633635 GGTGTAGGGTATGGATGTGGGGG - Intergenic
1012405432 6:98891597-98891619 AGACATGGGGCTGGATGTGGTGG + Intronic
1017127790 6:151081749-151081771 GGGCAAGGGTCTAGTTGTGAGGG + Intronic
1017202783 6:151773815-151773837 GGCAAAGGATTGGGATGTGGAGG + Intronic
1017544643 6:155438074-155438096 GCACCAGGGTGTGGATGTGGGGG + Intronic
1018068103 6:160137726-160137748 TGCCAGAGGACTGGATGTGGGGG - Intronic
1019512779 7:1426272-1426294 AACAAAGGGTCCGGATGTGGTGG + Intergenic
1019547688 7:1586360-1586382 GGCCAAGGGAGTGGCGGTGGAGG - Intergenic
1019710745 7:2517123-2517145 GACCTGGGGTCTGGATGGGGAGG + Intronic
1021695406 7:23271312-23271334 GGCCATCGGTCTGGGGGTGGGGG + Intronic
1022283137 7:28930661-28930683 TGCAAAGGGGCTGGAAGTGGAGG - Intergenic
1022533206 7:31079744-31079766 GGCCGGTGGTCTGGAGGTGGAGG - Intronic
1022603956 7:31790090-31790112 GGCCAAGGGTCAGGGGGTGGGGG + Intronic
1024287619 7:47772940-47772962 TACCAAGGGTCAGGCTGTGGAGG - Intronic
1024634343 7:51275197-51275219 GGCCCAAGGGCTGGCTGTGGAGG + Intronic
1027188581 7:75985530-75985552 GGGCAAGGGCCTCGGTGTGGCGG + Intronic
1029605823 7:101598910-101598932 GGCCCAGGATCTGGATGAGAGGG - Intergenic
1030095281 7:105893151-105893173 AGCCAGGGGTCTGTTTGTGGAGG + Intronic
1034405147 7:150897904-150897926 GGCCAAGGGTTTGTAGGTGTTGG - Intergenic
1034470106 7:151250340-151250362 GGCCCAGGCTCTGTGTGTGGGGG - Intronic
1035137006 7:156713466-156713488 GGGGAAGGCTCTGCATGTGGGGG + Intronic
1035301480 7:157900459-157900481 AGCCAGAGGTCTGGATGTTGAGG - Intronic
1035692676 8:1570591-1570613 GCCCAAGAGGCTGGCTGTGGAGG + Intronic
1036692817 8:10955466-10955488 GGCAGAGAGGCTGGATGTGGTGG - Intronic
1036941199 8:13054256-13054278 GCACAAGGGGCTGGGTGTGGTGG - Intergenic
1038611150 8:29061265-29061287 AACCAAAGTTCTGGATGTGGGGG + Intronic
1039470837 8:37812973-37812995 GGACAAGGGGCTGGGTGTGGTGG - Intronic
1039858329 8:41435380-41435402 GGCCAACTGTCTGGAGGAGGAGG + Intergenic
1040314312 8:46252945-46252967 GGCCAAGGTTTTGATTGTGGAGG - Intergenic
1042123525 8:65513464-65513486 TGCAAATGGTATGGATGTGGAGG + Intergenic
1042429218 8:68685566-68685588 GATCCAGGGTTTGGATGTGGTGG + Intronic
1048003947 8:130403039-130403061 GGTTGAGGGTTTGGATGTGGTGG - Intronic
1048021832 8:130546572-130546594 GGCCAAGGTAGGGGATGTGGAGG + Intergenic
1049168398 8:141141394-141141416 GACCAGGGGGCTGGAGGTGGTGG + Intronic
1049188112 8:141270030-141270052 GGGCAAGGGTCTGGAGGAGGCGG - Intronic
1049446257 8:142632914-142632936 GGCCATGGTGCTGGATGGGGTGG - Intergenic
1049587929 8:143440566-143440588 AGCCAAGGCCCTGGATGTGAGGG - Intronic
1049611005 8:143555316-143555338 GGCCAAGAGGCAGAATGTGGCGG + Intronic
1049662303 8:143824900-143824922 GGGCAGGGGTCTGGATGCGCAGG + Intronic
1050336062 9:4591006-4591028 GGTCAAGGGTCTGGCTGCAGGGG + Intronic
1051421856 9:16896813-16896835 GGCCTATGGGCTGGATGTGGTGG - Intergenic
1051542360 9:18234106-18234128 TGCTAAAGGTTTGGATGTGGGGG + Intergenic
1052841862 9:33298488-33298510 CACTTAGGGTCTGGATGTGGTGG + Intronic
1053162604 9:35824034-35824056 GGGCAAGGGTGGGGAGGTGGAGG + Intronic
1055474307 9:76646445-76646467 AGCCAAGGCTCTGTAGGTGGTGG - Intronic
1058544529 9:106046417-106046439 GGCCCACGGGCTGGTTGTGGTGG + Intergenic
1058651520 9:107179431-107179453 GTCCAAGGGTCTGGTTGTAGAGG + Intergenic
1058741757 9:107949896-107949918 GGTCAAGGGGCAGGATGGGGTGG + Intergenic
1060787759 9:126464095-126464117 GGCCCAGGGCCTGTAGGTGGGGG - Intronic
1061583714 9:131553698-131553720 AGCCAGGGGTCTGGCTTTGGAGG - Intergenic
1061778233 9:132980339-132980361 AACCAAGGGTCTGGATATTGTGG - Intronic
1061901564 9:133675054-133675076 GGCAAAGGGGCCGGGTGTGGTGG + Intronic
1062101429 9:134730602-134730624 GGCCCAGGGCCAGGGTGTGGTGG - Intronic
1062678463 9:137762679-137762701 GGCCAACGGTCCAGATGTGCTGG + Exonic
1203775059 EBV:68288-68310 GGCCAAGGCTCAGGACGTGGGGG + Intergenic
1203548421 Un_KI270743v1:147996-148018 GACCAAGGCCCTGGATGTGGGGG + Intergenic
1186454871 X:9703122-9703144 GGACACGGGGCTGGTTGTGGAGG + Intronic
1187741065 X:22355901-22355923 GGCGAAGGGTCTGGATATCTTGG - Intergenic
1187868526 X:23745314-23745336 GGCCATGAGTCTGGGTGAGGGGG - Intronic
1190157826 X:48007992-48008014 GGGCCTGGGTCTGAATGTGGCGG - Intronic
1190173598 X:48130877-48130899 GGGCCTGGGTCTGAATGTGGCGG - Intronic
1190240424 X:48653914-48653936 GGTCAAGGGGCTGCATCTGGTGG - Intergenic
1190793355 X:53720315-53720337 ACACAAGGGACTGGATGTGGTGG - Intergenic
1192034233 X:67545881-67545903 GTCCATGGGCCTGGGTGTGGAGG + Exonic
1194492384 X:94567951-94567973 GACCTAGGGTCTGGAATTGGAGG + Intergenic
1195284191 X:103367441-103367463 AGCCAGGGCTCTGGATCTGGGGG + Intergenic
1195584382 X:106548172-106548194 GGCCAGGGGCTGGGATGTGGGGG - Intergenic
1196254022 X:113494639-113494661 GGCTTGGGGTCTGGATGAGGAGG - Intergenic
1196820876 X:119699645-119699667 GGCATAGCATCTGGATGTGGTGG - Intergenic
1198806854 X:140502209-140502231 GGCCAAGGGTCAGGGACTGGAGG + Intergenic
1200339031 X:155380978-155381000 GGCCAAGGTCCTGGAGCTGGCGG + Exonic
1200347438 X:155459714-155459736 GGCCAAGGTCCTGGAGCTGGCGG - Exonic
1200841081 Y:7782448-7782470 GGACAAGGGTGTGGATTTTGAGG - Intergenic
1201893121 Y:18964429-18964451 TGCAAAGGGTATGGATGGGGAGG - Intergenic
1202195814 Y:22297597-22297619 GGGCACGGGTCTGTAAGTGGAGG + Intergenic