ID: 908384007

View in Genome Browser
Species Human (GRCh38)
Location 1:63623266-63623288
Sequence GTCCCTTGTGAACAAGTTAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908384007_908384009 -10 Left 908384007 1:63623266-63623288 CCCTTAACTTGTTCACAAGGGAC 0: 1
1: 0
2: 0
3: 13
4: 76
Right 908384009 1:63623279-63623301 CACAAGGGACAACAACAACAAGG 0: 1
1: 0
2: 0
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908384007 Original CRISPR GTCCCTTGTGAACAAGTTAA GGG (reversed) Exonic
907412056 1:54289924-54289946 GTCCCTTGTGACCCAGCTCATGG + Intronic
908384007 1:63623266-63623288 GTCCCTTGTGAACAAGTTAAGGG - Exonic
910227987 1:84955969-84955991 ATCCCTTGGCAACAAGTTAATGG - Intronic
911271725 1:95809906-95809928 ATGCCATGTGAACAAGTGAAAGG - Intergenic
916314958 1:163438753-163438775 GTCCCATGTCAACAAGGGAAGGG - Intergenic
916602592 1:166307564-166307586 TTCCCTGGTGATCTAGTTAATGG + Intergenic
918446406 1:184621502-184621524 GTCCCCAGTGAACAAGTTTGAGG - Exonic
1065577060 10:27131860-27131882 GTCACCTTTGAACATGTTAAAGG - Exonic
1068711351 10:60138437-60138459 GTCCCTTGTAAACAAAATAATGG + Intronic
1070479374 10:76867283-76867305 TTCTCCTGTGAACAAGTTAACGG + Intergenic
1073356208 10:102856593-102856615 GTTAATTATGAACAAGTTAATGG + Intronic
1074077685 10:110143568-110143590 GTCCCTTGTGAGCAACAGAAAGG - Intergenic
1081918528 11:46750430-46750452 GTCCCTGGTGAACAGGAAAAGGG + Exonic
1095666868 12:44812365-44812387 GTCCTTAGAGAACAAGTTCAGGG - Intronic
1095795843 12:46218073-46218095 GTTCTTTGTAAAAAAGTTAAAGG + Intronic
1099816552 12:87656299-87656321 ATCTCTTGTATACAAGTTAAGGG + Intergenic
1100011000 12:89952856-89952878 GTCCCTTGTGAACAAACAAAGGG + Intergenic
1104226862 12:126843482-126843504 GGCTCCTTTGAACAAGTTAAAGG - Intergenic
1107452638 13:40524663-40524685 GTACCTTGGGAACAAGGTAAGGG + Intergenic
1111274664 13:85933257-85933279 GTCCCTTGCCAACTTGTTAATGG + Intergenic
1111356482 13:87111520-87111542 TTTCAGTGTGAACAAGTTAATGG - Intergenic
1111857117 13:93652118-93652140 GTTTCTTGTGAACAAGTTATTGG - Intronic
1113609862 13:111636729-111636751 CTCCATTGTGGAAAAGTTAAGGG - Intronic
1114667564 14:24388858-24388880 ATCCTTTGTGAACAAATAAATGG - Intergenic
1114859152 14:26493797-26493819 GCCCCCTGTGAACAAGTTCTTGG + Intronic
1117434332 14:55701844-55701866 ATGCTTAGTGAACAAGTTAATGG + Intergenic
1121844019 14:97157621-97157643 GTCACTTGTGAGCACATTAAGGG + Intergenic
1122484092 14:102066374-102066396 GGCCCTTGTGGCCATGTTAAAGG - Intergenic
1132418464 15:101642759-101642781 GTCACTTGTGTTCCAGTTAAGGG - Intronic
1139195529 16:64914503-64914525 TTGCCTTGTGAACAAGAAAAGGG + Intergenic
1141094316 16:81152169-81152191 GTGCCATGTGTACAGGTTAATGG - Intergenic
1159235067 18:65660659-65660681 GTCCATTGGGGACAAGTTAAAGG + Intergenic
928183108 2:29083737-29083759 GTCTCATGTTAACATGTTAACGG - Intergenic
936234445 2:110731496-110731518 GTCCCATGTAAACAAGTCCAAGG + Intergenic
937513441 2:122625590-122625612 ATCCTTGGTGAACAATTTAATGG + Intergenic
938637360 2:133243256-133243278 GTCCCTTTTGAACAAATAAGTGG + Intronic
940284701 2:152022347-152022369 GTCCTTTGTGAAATAGTTATTGG - Intronic
941750706 2:169132677-169132699 GTCACCTGTGGACATGTTAAAGG + Exonic
941753928 2:169164366-169164388 GTCCCTTGGGAAGGGGTTAAGGG + Intronic
944304225 2:198160299-198160321 GTATCTTGTGAACAAGATAAAGG + Intronic
945002849 2:205370078-205370100 GACCCTTGCAAACAAGTTAGGGG + Intronic
946531696 2:220577654-220577676 TTCCCTTGTGAACCAGGAAAAGG + Intergenic
1169930058 20:10822940-10822962 TTCCCTGGTGAATAAGCTAACGG + Intergenic
1170393776 20:15903893-15903915 GTCACTTTTGGACACGTTAAAGG + Intronic
1170702431 20:18715229-18715251 GTCCCTGGAGTACAAGTTTAGGG - Intronic
1175135411 20:56819737-56819759 CTTCCCTGTGAACAAATTAATGG - Intergenic
1176310042 21:5144695-5144717 GTCCCTCCTGAACAAGTGACAGG + Intronic
1179847014 21:44117337-44117359 GTCCCTCCTGAACAAGTGACAGG - Intronic
1181277463 22:21695657-21695679 GGCCCTTGGCAACAGGTTAAGGG - Intronic
1182228283 22:28817030-28817052 GTCCCCTGAGAGCAAGATAAAGG - Intergenic
1185124962 22:49004847-49004869 GTCCCTTGTCATCAAGTGCATGG - Intergenic
954101042 3:48372842-48372864 TTCCCAGGTGAACAAGGTAAAGG + Exonic
956770392 3:72521028-72521050 GTCCAGGGTGAAAAAGTTAATGG - Intergenic
958977576 3:100683851-100683873 GTCTTTGATGAACAAGTTAAAGG - Intronic
962625384 3:137220768-137220790 GTCCACTGTGAACCAGATAAGGG + Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
963999579 3:151753829-151753851 GTATCTTGTGAACAAGTAACTGG + Intronic
964993960 3:162851047-162851069 GTCACTTATGAACAATTTGAGGG - Intergenic
967971855 3:195005127-195005149 GCTCCTTGTGAATAAGGTAAGGG + Intergenic
975559690 4:75697530-75697552 GTATCTTGTAAACAAGTGAAAGG + Intronic
978764604 4:112391255-112391277 TTGCCTTGTGAACAAGGTAGGGG + Intronic
980326185 4:131349866-131349888 TTCTCTTGGTAACAAGTTAAAGG + Intergenic
981230504 4:142348720-142348742 GTCCCTAGTGAACAATTTGAAGG + Intronic
987629065 5:20443918-20443940 TTACCTTGTAAAAAAGTTAATGG - Intronic
989411176 5:41121672-41121694 TGCCCTTGTGAAAAAGTGAATGG + Intergenic
993391820 5:87327582-87327604 GTCTCTTTTGAACAAGCTCAGGG + Intronic
995774072 5:115706916-115706938 GCCCCGTGAGATCAAGTTAATGG - Intergenic
998805181 5:145911699-145911721 GTCCCTTCTGAACGAATTAAAGG - Intergenic
1000947846 5:167443791-167443813 GTCCCCTGTTTTCAAGTTAAAGG - Intronic
1004392859 6:15223879-15223901 GGGCCTTGTGCACAAGTTATTGG - Intergenic
1005023420 6:21439419-21439441 GTGCTTTGAGAAGAAGTTAAGGG + Intergenic
1005589476 6:27309888-27309910 GTCCCTTGGGATCAAGCTCAAGG - Exonic
1013270287 6:108538712-108538734 GTGCCTTCTGTAAAAGTTAATGG - Intergenic
1014736520 6:125100701-125100723 GTCCCTGGTTAACAAGAGAAGGG - Intergenic
1015238835 6:131001235-131001257 TTCCATGGTGAACAAGTTGAGGG + Intronic
1016839630 6:148513491-148513513 TTCCCTTGTGAACAAAATGAGGG - Intronic
1020081687 7:5289567-5289589 TTCCCTTTTGATAAAGTTAATGG + Intronic
1022395047 7:29980189-29980211 GTTCTTTATGATCAAGTTAAAGG - Intronic
1024595818 7:50936437-50936459 GTCACTTGGGAACACATTAATGG - Intergenic
1026653116 7:72233107-72233129 GTCCCTTGTGACCAAAATAAAGG - Intronic
1027630554 7:80599619-80599641 GTCCATTGTGTAAAAGTTAATGG - Intronic
1034780337 7:153873629-153873651 CTTCCTTGTGAACAGGTGAATGG + Intergenic
1035724471 8:1816039-1816061 GTCCCTCGTGAATAGATTAATGG - Intergenic
1039428806 8:37509656-37509678 GTCCTTAGAGAACAAGTTCAGGG + Intergenic
1048102264 8:131366112-131366134 TTTCCTTCTGAACAAATTAAAGG - Intergenic
1052045601 9:23790585-23790607 GTCCCTCAAGAAAAAGTTAAAGG + Intronic
1059946786 9:119417323-119417345 ATCCTTTAAGAACAAGTTAAAGG + Intergenic
1189065888 X:37808340-37808362 ATCCCTTATGAATGAGTTAAGGG - Intronic
1197270580 X:124420583-124420605 GTCCCTTGTTATCAAGTTCAGGG + Exonic
1199359464 X:146902060-146902082 GTCCCTTGTAGACAGATTAAAGG - Intergenic