ID: 908386144

View in Genome Browser
Species Human (GRCh38)
Location 1:63643678-63643700
Sequence AGTCTGCCCAAAGAATGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908386144_908386151 15 Left 908386144 1:63643678-63643700 CCCGGCCATTCTTTGGGCAGACT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 908386151 1:63643716-63643738 TTTGGGCCAACCCCTGTTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 132
908386144_908386149 13 Left 908386144 1:63643678-63643700 CCCGGCCATTCTTTGGGCAGACT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 908386149 1:63643714-63643736 ACTTTGGGCCAACCCCTGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81
908386144_908386150 14 Left 908386144 1:63643678-63643700 CCCGGCCATTCTTTGGGCAGACT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 908386150 1:63643715-63643737 CTTTGGGCCAACCCCTGTTTGGG No data
908386144_908386148 -2 Left 908386144 1:63643678-63643700 CCCGGCCATTCTTTGGGCAGACT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 908386148 1:63643699-63643721 CTGTCTTAACAACTGACTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 195
908386144_908386147 -3 Left 908386144 1:63643678-63643700 CCCGGCCATTCTTTGGGCAGACT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 908386147 1:63643698-63643720 ACTGTCTTAACAACTGACTTTGG 0: 1
1: 0
2: 1
3: 7
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908386144 Original CRISPR AGTCTGCCCAAAGAATGGCC GGG (reversed) Intronic
900323491 1:2096136-2096158 CGGCTGCCCCAAGACTGGCCCGG + Intronic
901368418 1:8774647-8774669 AGTTTGCCAAAATGATGGCCGGG - Intronic
904277767 1:29395370-29395392 TTTCTGCCCAGAGAAGGGCCGGG - Intergenic
906038043 1:42765268-42765290 AGCCTGCCCTAAGTATTGCCAGG - Intronic
906284699 1:44579334-44579356 AGTCTGAGCAAAGAAAGGACAGG + Intronic
907520241 1:55019244-55019266 GAGCTGCCCAAAGAATGGGCAGG - Intergenic
908386144 1:63643678-63643700 AGTCTGCCCAAAGAATGGCCGGG - Intronic
912442384 1:109709224-109709246 AGTCTGACCACAGATTTGCCAGG - Intronic
912711769 1:111955039-111955061 AGTATGTGCAAAGAAAGGCCTGG - Intronic
918287300 1:183069946-183069968 AGCCTGAAAAAAGAATGGCCCGG + Intronic
920548696 1:206840039-206840061 TGTCTGCCCAAGGAGAGGCCAGG + Intronic
921540745 1:216411656-216411678 TGTCTGCCCACAGCAAGGCCGGG - Intronic
922651446 1:227342488-227342510 TGTCTGCCCAAAGAATACACAGG - Intergenic
924330486 1:242936194-242936216 AGTTTGCCCAGAGACTAGCCTGG - Intergenic
1062838629 10:652435-652457 AGGCTGGCCCAAGAATAGCCTGG + Exonic
1062968247 10:1626572-1626594 AGTCTGCCTCACGGATGGCCTGG - Intronic
1063240837 10:4167657-4167679 AATCTGGCAAAAGGATGGCCAGG + Intergenic
1063504186 10:6580776-6580798 AGTGTGCCCAAACAAATGCCTGG - Intergenic
1064031284 10:11885047-11885069 AGCCTACCCACAGACTGGCCAGG + Intergenic
1065121030 10:22530552-22530574 TGTCTGCCCAAAGAGCCGCCCGG + Intergenic
1067216778 10:44310334-44310356 AGTGTGCCCAAGCAATGTCCCGG + Intergenic
1069718433 10:70535167-70535189 AGTCTTCCCAAAGAAACACCAGG - Intronic
1070519031 10:77235843-77235865 ACTTTGCCCAAAGAGAGGCCTGG + Intronic
1071793322 10:88979432-88979454 AGTCTGGCCAAATAATTGTCAGG + Intronic
1075830818 10:125409289-125409311 AGGCTGGCCAGAGAATGACCAGG + Intergenic
1075922047 10:126221785-126221807 ATTCTCCCCAAAGAATGACAGGG + Intronic
1076175798 10:128366926-128366948 GGTGTGCCCAGAGCATGGCCAGG + Intergenic
1076885194 10:133258920-133258942 CGGCTTCCCAAAGACTGGCCTGG - Intergenic
1081140067 11:39487629-39487651 AGTTTGCCATCAGAATGGCCTGG - Intergenic
1081322271 11:41705762-41705784 ACTCTGCTCAAAGAAAGGGCAGG + Intergenic
1083491842 11:63019495-63019517 AATCTGCCCAAAGTAAGGCTAGG - Intergenic
1088847409 11:113680117-113680139 GGTCTGGTCAAAGAAGGGCCAGG - Intergenic
1095783911 12:46089674-46089696 ATTCTGCCCAAAAATTGGCATGG + Intergenic
1097346174 12:58495421-58495443 AGTATGCCCAAAGAATTGGGAGG + Intergenic
1102466475 12:113133592-113133614 ATTCTGCCTAAAGCATTGCCAGG - Intronic
1103105746 12:118223352-118223374 ACTCTGCCTCAAAAATGGCCAGG - Intronic
1108347837 13:49563910-49563932 AGTCTAGACAAAGAAAGGCCGGG + Intronic
1109623163 13:64937090-64937112 AGTCTGTGCAAAGCATGGACTGG - Intergenic
1111201558 13:84944749-84944771 CCTCTGCCCAAAAAATGGTCAGG + Intergenic
1115198233 14:30825234-30825256 ACTCTGTCCAAAAAATGCCCTGG + Intergenic
1116399757 14:44492098-44492120 ACCTTGCCCAAAGAAAGGCCTGG + Intergenic
1118444799 14:65841235-65841257 AGTCAGCCCAATGAATGGGTTGG + Intergenic
1118878905 14:69809706-69809728 AATTTAACCAAAGAATGGCCGGG + Intergenic
1125160811 15:36641436-36641458 AGTGGACCCAAAGAATGGCTAGG - Intronic
1125769642 15:42156534-42156556 AGAGTGCCCAAAGCATGGCTGGG + Exonic
1129372881 15:75109151-75109173 AGGCTGCCCAGAGAAAGGCATGG - Intronic
1129893510 15:79087606-79087628 AGCCTGGTCACAGAATGGCCTGG + Intronic
1130334355 15:82946347-82946369 AGTCAACCCAAAGACTGGTCTGG + Intronic
1132940957 16:2507910-2507932 TGTCTGCCCAGAGCTTGGCCAGG + Intronic
1137551577 16:49440980-49441002 AGTTTCCCCAAACAATGGCTTGG + Intergenic
1137760384 16:50935545-50935567 AGCCAGCCCACAGAAGGGCCAGG - Intergenic
1141648046 16:85377913-85377935 AGGCTGCCCAAGGAGCGGCCAGG - Intergenic
1142255018 16:89009526-89009548 GGTCTGCCCAGGGAATGGACAGG + Intergenic
1142836652 17:2592965-2592987 CGGATGCCCAAAGAAAGGCCTGG - Intergenic
1146522108 17:33533624-33533646 AGTCTGCCCCATGGATTGCCTGG + Intronic
1147420626 17:40320578-40320600 AGTCTGAGCAAGGAGTGGCCTGG - Intronic
1148163873 17:45468774-45468796 AGTCTGCCTAAATCCTGGCCAGG - Intronic
1150395103 17:64815426-64815448 AGTCTGCCTAAATCCTGGCCAGG - Intergenic
1151015976 17:70553134-70553156 AGTTTGCCATGAGAATGGCCAGG - Intergenic
1151871191 17:76838093-76838115 AGGCCACCCAAAGAATGCCCGGG + Intergenic
1154411910 18:14146188-14146210 GAGCTGCTCAAAGAATGGCCCGG - Intergenic
1157593264 18:48848693-48848715 AGGCTGCCCAAGGCATGCCCAGG - Intronic
1159068005 18:63590903-63590925 AGTTTGCCCAGAGACTGGCTTGG + Intronic
1161680610 19:5678008-5678030 AGTCCGGCCAAGGAAGGGCCGGG + Intronic
1163749783 19:19069541-19069563 AGTTTGCCCGGAGAAAGGCCTGG - Intronic
1167263042 19:48469708-48469730 GCTCAGCCCAAACAATGGCCTGG - Intronic
1167284369 19:48590671-48590693 TTTCTGCCCAGAGAAAGGCCTGG - Intronic
1168686431 19:58352097-58352119 AGGATGCCCAAAGAATGGAAGGG - Intronic
927384719 2:22520152-22520174 GGTATGCCCAGGGAATGGCCAGG - Intergenic
932018916 2:68062863-68062885 AGTCTGCCCAGAGGATGACAGGG + Intronic
934144855 2:89081895-89081917 GGTCTTCCAAAAGAATGGGCCGG + Intergenic
935172340 2:100620205-100620227 GGTCTGCCCAAACGATGGCTGGG + Intergenic
938387666 2:130878896-130878918 ATGATGCCCAAAAAATGGCCAGG - Intronic
940805686 2:158184004-158184026 AGTCTGCCCAAAGAAAAGAATGG + Intronic
943096775 2:183438673-183438695 ATTCTTCCCAAAGCATGGCCAGG + Intergenic
948081340 2:235207721-235207743 AGACTGCCCAGAGAATGGGTTGG - Intergenic
1169274017 20:4221180-4221202 AGACAGCCCCAAGCATGGCCAGG - Exonic
1176861123 21:14012144-14012166 AAGCTGCTCAAAGAATGGCCCGG + Intergenic
1177492414 21:21844807-21844829 AATGTTCCCAAATAATGGCCAGG - Intergenic
1181799151 22:25332978-25333000 TGTCTGCCGAAAGCATGGCATGG + Intergenic
1182720118 22:32390993-32391015 AGTTTGGCCAAAGATTAGCCAGG - Intronic
953271293 3:41447826-41447848 AGGCTGCCCAATGAATGTCAGGG + Intronic
961188333 3:124935438-124935460 GGCCTGCCCAATGAGTGGCCAGG - Intronic
961633982 3:128321494-128321516 GGTCTGCCCAGAGACTGTCCTGG - Intronic
967120217 3:186375991-186376013 AGTGTGCTCAAAGAACAGCCAGG + Intergenic
967443973 3:189543256-189543278 AGGCTGACTAAAGAATGGCAGGG + Intergenic
969119391 4:4896751-4896773 AGTCTGGGCACAGAATGGCTGGG + Intergenic
971930113 4:33070581-33070603 TGTCTTCCAAAAGTATGGCCTGG + Intergenic
973731101 4:53823074-53823096 AGTCTACCCAAGGAATGGGTGGG - Intronic
977984586 4:103367094-103367116 AGTCTGGGCAAAGAATGTCCCGG + Intergenic
978310018 4:107377355-107377377 TGTATGGCCAAAAAATGGCCTGG - Intergenic
978933963 4:114353540-114353562 AGTCTGGCTAAAGATTTGCCAGG + Intergenic
980226263 4:129990481-129990503 TATTTGACCAAAGAATGGCCAGG + Intergenic
982351038 4:154415749-154415771 ATTCAGCCCAAAGCGTGGCCAGG + Intronic
984802780 4:183730014-183730036 AGTCTGTGCAATGAATGGCCTGG - Intergenic
985850441 5:2384632-2384654 AGCCTGACCAAGGAATGGCAGGG - Intergenic
990369969 5:55107806-55107828 AGTGAGCCCCAAGAATGACCTGG - Exonic
990631950 5:57680069-57680091 ATTTTGCCCAAGAAATGGCCTGG + Intergenic
990742215 5:58923510-58923532 AGCCTGCCCAAACAAAGACCAGG + Intergenic
995263824 5:110136082-110136104 AGTCATCCAAAAGAATCGCCTGG + Intergenic
1004246163 6:13978101-13978123 AGTCTTCCCAGAGAAAGGACAGG + Exonic
1007026193 6:38577185-38577207 AGTCTTCCCTGGGAATGGCCAGG - Intronic
1007196044 6:40061550-40061572 AGTCTGCCCAAAGAAATACTCGG - Intergenic
1010207939 6:73339608-73339630 AGTCAGCCCAAAGAATTCCAAGG + Intergenic
1012193385 6:96308756-96308778 AGTCTTCCCAAATAATGTCAAGG - Intergenic
1013610917 6:111794130-111794152 AGAGTGACCAAAGAAAGGCCCGG - Intronic
1013623179 6:111910016-111910038 AGTAGGCCCTTAGAATGGCCTGG + Intergenic
1014122752 6:117745341-117745363 AGTCTGTCCAAAGAATGACGTGG + Intergenic
1015462666 6:133510690-133510712 AGACTGCCCAAGGAATGGCCTGG - Intronic
1015768764 6:136747399-136747421 ACTCTGGCCAAAGAATGTACAGG + Intronic
1023901165 7:44480644-44480666 AATATTCCCAAAAAATGGCCAGG + Intronic
1024176709 7:46847697-46847719 AGTCTGACCAGAGAGTAGCCAGG + Intergenic
1029936525 7:104430761-104430783 AATCAGCCCACAGAAGGGCCGGG - Intronic
1033545884 7:142399877-142399899 AGTCTGCCCACAGCAGGGCTGGG + Intergenic
1035948301 8:3990372-3990394 ACTCTGCCCTAAGAATGGTAAGG + Intronic
1046426404 8:114056840-114056862 ACTCTGCTGAAAGAATGGGCTGG - Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1048183373 8:132216466-132216488 ATTCTGCCCAAAGACAGGGCTGG - Intronic
1061062393 9:128257226-128257248 AGCCTGCCCAAGGAGAGGCCAGG - Exonic
1062033992 9:134374626-134374648 TGTCTACCCAGAGAATGGCCAGG + Intronic
1195705020 X:107732314-107732336 AGTCTGCCCAGAAGCTGGCCTGG - Intronic
1200409254 Y:2845240-2845262 AGGCTGCCCAATCAATGTCCTGG - Intronic