ID: 908386144

View in Genome Browser
Species Human (GRCh38)
Location 1:63643678-63643700
Sequence AGTCTGCCCAAAGAATGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908386144_908386149 13 Left 908386144 1:63643678-63643700 CCCGGCCATTCTTTGGGCAGACT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 908386149 1:63643714-63643736 ACTTTGGGCCAACCCCTGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81
908386144_908386148 -2 Left 908386144 1:63643678-63643700 CCCGGCCATTCTTTGGGCAGACT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 908386148 1:63643699-63643721 CTGTCTTAACAACTGACTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 195
908386144_908386150 14 Left 908386144 1:63643678-63643700 CCCGGCCATTCTTTGGGCAGACT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 908386150 1:63643715-63643737 CTTTGGGCCAACCCCTGTTTGGG No data
908386144_908386147 -3 Left 908386144 1:63643678-63643700 CCCGGCCATTCTTTGGGCAGACT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 908386147 1:63643698-63643720 ACTGTCTTAACAACTGACTTTGG 0: 1
1: 0
2: 1
3: 7
4: 154
908386144_908386151 15 Left 908386144 1:63643678-63643700 CCCGGCCATTCTTTGGGCAGACT 0: 1
1: 0
2: 1
3: 6
4: 114
Right 908386151 1:63643716-63643738 TTTGGGCCAACCCCTGTTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908386144 Original CRISPR AGTCTGCCCAAAGAATGGCC GGG (reversed) Intronic