ID: 908388985

View in Genome Browser
Species Human (GRCh38)
Location 1:63668427-63668449
Sequence CTGTAAACACTGAAACAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908388977_908388985 29 Left 908388977 1:63668375-63668397 CCAGGATTTCAACATATGAAATT No data
Right 908388985 1:63668427-63668449 CTGTAAACACTGAAACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908388985 Original CRISPR CTGTAAACACTGAAACAGCT GGG Intergenic
No off target data available for this crispr