ID: 908389090

View in Genome Browser
Species Human (GRCh38)
Location 1:63669349-63669371
Sequence CTGTGGGAATAGAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908389085_908389090 8 Left 908389085 1:63669318-63669340 CCTTGGGATAGAGGTCTCTGTGC No data
Right 908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG No data
908389082_908389090 20 Left 908389082 1:63669306-63669328 CCCTGCATCAGGCCTTGGGATAG No data
Right 908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG No data
908389083_908389090 19 Left 908389083 1:63669307-63669329 CCTGCATCAGGCCTTGGGATAGA No data
Right 908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908389090 Original CRISPR CTGTGGGAATAGAGGGATGA AGG Intergenic
No off target data available for this crispr