ID: 908389713

View in Genome Browser
Species Human (GRCh38)
Location 1:63673515-63673537
Sequence AATTATCTGGACATGATGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908389713_908389717 0 Left 908389713 1:63673515-63673537 CCCGCCATCATGTCCAGATAATT No data
Right 908389717 1:63673538-63673560 TTTGTATTTTTAGTAGAGACAGG 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
908389713_908389719 15 Left 908389713 1:63673515-63673537 CCCGCCATCATGTCCAGATAATT No data
Right 908389719 1:63673553-63673575 GAGACAGGGTTTCACCATCTTGG 0: 1349
1: 39104
2: 92976
3: 135100
4: 110013
908389713_908389721 24 Left 908389713 1:63673515-63673537 CCCGCCATCATGTCCAGATAATT No data
Right 908389721 1:63673562-63673584 TTTCACCATCTTGGCCAGGCTGG 0: 5168
1: 104203
2: 162855
3: 169007
4: 157895
908389713_908389718 1 Left 908389713 1:63673515-63673537 CCCGCCATCATGTCCAGATAATT No data
Right 908389718 1:63673539-63673561 TTGTATTTTTAGTAGAGACAGGG 0: 62759
1: 158911
2: 184886
3: 115845
4: 74212
908389713_908389720 20 Left 908389713 1:63673515-63673537 CCCGCCATCATGTCCAGATAATT No data
Right 908389720 1:63673558-63673580 AGGGTTTCACCATCTTGGCCAGG 0: 1397
1: 38280
2: 133157
3: 182281
4: 187670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908389713 Original CRISPR AATTATCTGGACATGATGGC GGG (reversed) Intergenic
No off target data available for this crispr