ID: 908391748

View in Genome Browser
Species Human (GRCh38)
Location 1:63689405-63689427
Sequence GCACAGTGCCTGGCCACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908391742_908391748 -1 Left 908391742 1:63689383-63689405 CCTGCGGTATCACCAGCCCCTAG No data
Right 908391748 1:63689405-63689427 GCACAGTGCCTGGCCACAACAGG No data
908391740_908391748 3 Left 908391740 1:63689379-63689401 CCACCCTGCGGTATCACCAGCCC No data
Right 908391748 1:63689405-63689427 GCACAGTGCCTGGCCACAACAGG No data
908391738_908391748 26 Left 908391738 1:63689356-63689378 CCTGAGGGGGCATAGCAGCTCTG No data
Right 908391748 1:63689405-63689427 GCACAGTGCCTGGCCACAACAGG No data
908391741_908391748 0 Left 908391741 1:63689382-63689404 CCCTGCGGTATCACCAGCCCCTA No data
Right 908391748 1:63689405-63689427 GCACAGTGCCTGGCCACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908391748 Original CRISPR GCACAGTGCCTGGCCACAAC AGG Intergenic
No off target data available for this crispr